ID: 924844287

View in Genome Browser
Species Human (GRCh38)
Location 1:247749884-247749906
Sequence GCCTAGTGGCTTTGTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844287_924844294 22 Left 924844287 1:247749884-247749906 CCACACAGACAAAGCCACTAGGC No data
Right 924844294 1:247749929-247749951 AGGCTGACTCTCATGGACTATGG No data
924844287_924844295 28 Left 924844287 1:247749884-247749906 CCACACAGACAAAGCCACTAGGC No data
Right 924844295 1:247749935-247749957 ACTCTCATGGACTATGGTCTAGG No data
924844287_924844290 2 Left 924844287 1:247749884-247749906 CCACACAGACAAAGCCACTAGGC No data
Right 924844290 1:247749909-247749931 GCATCTGAGACCTTGTTTCCAGG No data
924844287_924844292 15 Left 924844287 1:247749884-247749906 CCACACAGACAAAGCCACTAGGC No data
Right 924844292 1:247749922-247749944 TGTTTCCAGGCTGACTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924844287 Original CRISPR GCCTAGTGGCTTTGTCTGTG TGG (reversed) Intergenic