ID: 924844288 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:247749898-247749920 |
| Sequence | GGTCTCAGATGCTGGCCTAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924844288_924844292 | 1 | Left | 924844288 | 1:247749898-247749920 | CCACTAGGCCAGCATCTGAGACC | No data | ||
| Right | 924844292 | 1:247749922-247749944 | TGTTTCCAGGCTGACTCTCATGG | No data | ||||
| 924844288_924844295 | 14 | Left | 924844288 | 1:247749898-247749920 | CCACTAGGCCAGCATCTGAGACC | No data | ||
| Right | 924844295 | 1:247749935-247749957 | ACTCTCATGGACTATGGTCTAGG | No data | ||||
| 924844288_924844294 | 8 | Left | 924844288 | 1:247749898-247749920 | CCACTAGGCCAGCATCTGAGACC | No data | ||
| Right | 924844294 | 1:247749929-247749951 | AGGCTGACTCTCATGGACTATGG | No data | ||||
| 924844288_924844296 | 28 | Left | 924844288 | 1:247749898-247749920 | CCACTAGGCCAGCATCTGAGACC | No data | ||
| Right | 924844296 | 1:247749949-247749971 | TGGTCTAGGCTAGCCCCTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924844288 | Original CRISPR | GGTCTCAGATGCTGGCCTAG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||