ID: 924844288

View in Genome Browser
Species Human (GRCh38)
Location 1:247749898-247749920
Sequence GGTCTCAGATGCTGGCCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844288_924844292 1 Left 924844288 1:247749898-247749920 CCACTAGGCCAGCATCTGAGACC No data
Right 924844292 1:247749922-247749944 TGTTTCCAGGCTGACTCTCATGG No data
924844288_924844295 14 Left 924844288 1:247749898-247749920 CCACTAGGCCAGCATCTGAGACC No data
Right 924844295 1:247749935-247749957 ACTCTCATGGACTATGGTCTAGG No data
924844288_924844294 8 Left 924844288 1:247749898-247749920 CCACTAGGCCAGCATCTGAGACC No data
Right 924844294 1:247749929-247749951 AGGCTGACTCTCATGGACTATGG No data
924844288_924844296 28 Left 924844288 1:247749898-247749920 CCACTAGGCCAGCATCTGAGACC No data
Right 924844296 1:247749949-247749971 TGGTCTAGGCTAGCCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924844288 Original CRISPR GGTCTCAGATGCTGGCCTAG TGG (reversed) Intergenic
No off target data available for this crispr