ID: 924844289

View in Genome Browser
Species Human (GRCh38)
Location 1:247749906-247749928
Sequence GGAAACAAGGTCTCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844289_924844296 20 Left 924844289 1:247749906-247749928 CCAGCATCTGAGACCTTGTTTCC No data
Right 924844296 1:247749949-247749971 TGGTCTAGGCTAGCCCCTCATGG No data
924844289_924844292 -7 Left 924844289 1:247749906-247749928 CCAGCATCTGAGACCTTGTTTCC No data
Right 924844292 1:247749922-247749944 TGTTTCCAGGCTGACTCTCATGG No data
924844289_924844294 0 Left 924844289 1:247749906-247749928 CCAGCATCTGAGACCTTGTTTCC No data
Right 924844294 1:247749929-247749951 AGGCTGACTCTCATGGACTATGG No data
924844289_924844295 6 Left 924844289 1:247749906-247749928 CCAGCATCTGAGACCTTGTTTCC No data
Right 924844295 1:247749935-247749957 ACTCTCATGGACTATGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924844289 Original CRISPR GGAAACAAGGTCTCAGATGC TGG (reversed) Intergenic