ID: 924844291

View in Genome Browser
Species Human (GRCh38)
Location 1:247749919-247749941
Sequence TGAGAGTCAGCCTGGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844291_924844299 21 Left 924844291 1:247749919-247749941 CCTTGTTTCCAGGCTGACTCTCA No data
Right 924844299 1:247749963-247749985 CCCTCATGGCCACAAGCAACAGG No data
924844291_924844296 7 Left 924844291 1:247749919-247749941 CCTTGTTTCCAGGCTGACTCTCA No data
Right 924844296 1:247749949-247749971 TGGTCTAGGCTAGCCCCTCATGG No data
924844291_924844295 -7 Left 924844291 1:247749919-247749941 CCTTGTTTCCAGGCTGACTCTCA No data
Right 924844295 1:247749935-247749957 ACTCTCATGGACTATGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924844291 Original CRISPR TGAGAGTCAGCCTGGAAACA AGG (reversed) Intergenic