ID: 924844292

View in Genome Browser
Species Human (GRCh38)
Location 1:247749922-247749944
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844285_924844292 19 Left 924844285 1:247749880-247749902 CCAACCACACAGACAAAGCCACT No data
Right 924844292 1:247749922-247749944 TGTTTCCAGGCTGACTCTCATGG No data
924844288_924844292 1 Left 924844288 1:247749898-247749920 CCACTAGGCCAGCATCTGAGACC No data
Right 924844292 1:247749922-247749944 TGTTTCCAGGCTGACTCTCATGG No data
924844287_924844292 15 Left 924844287 1:247749884-247749906 CCACACAGACAAAGCCACTAGGC No data
Right 924844292 1:247749922-247749944 TGTTTCCAGGCTGACTCTCATGG No data
924844289_924844292 -7 Left 924844289 1:247749906-247749928 CCAGCATCTGAGACCTTGTTTCC No data
Right 924844292 1:247749922-247749944 TGTTTCCAGGCTGACTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type