ID: 924844295

View in Genome Browser
Species Human (GRCh38)
Location 1:247749935-247749957
Sequence ACTCTCATGGACTATGGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844288_924844295 14 Left 924844288 1:247749898-247749920 CCACTAGGCCAGCATCTGAGACC No data
Right 924844295 1:247749935-247749957 ACTCTCATGGACTATGGTCTAGG No data
924844289_924844295 6 Left 924844289 1:247749906-247749928 CCAGCATCTGAGACCTTGTTTCC No data
Right 924844295 1:247749935-247749957 ACTCTCATGGACTATGGTCTAGG No data
924844287_924844295 28 Left 924844287 1:247749884-247749906 CCACACAGACAAAGCCACTAGGC No data
Right 924844295 1:247749935-247749957 ACTCTCATGGACTATGGTCTAGG No data
924844291_924844295 -7 Left 924844291 1:247749919-247749941 CCTTGTTTCCAGGCTGACTCTCA No data
Right 924844295 1:247749935-247749957 ACTCTCATGGACTATGGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924844295 Original CRISPR ACTCTCATGGACTATGGTCT AGG Intergenic