ID: 924844296

View in Genome Browser
Species Human (GRCh38)
Location 1:247749949-247749971
Sequence TGGTCTAGGCTAGCCCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924844288_924844296 28 Left 924844288 1:247749898-247749920 CCACTAGGCCAGCATCTGAGACC No data
Right 924844296 1:247749949-247749971 TGGTCTAGGCTAGCCCCTCATGG No data
924844289_924844296 20 Left 924844289 1:247749906-247749928 CCAGCATCTGAGACCTTGTTTCC No data
Right 924844296 1:247749949-247749971 TGGTCTAGGCTAGCCCCTCATGG No data
924844293_924844296 -1 Left 924844293 1:247749927-247749949 CCAGGCTGACTCTCATGGACTAT No data
Right 924844296 1:247749949-247749971 TGGTCTAGGCTAGCCCCTCATGG No data
924844291_924844296 7 Left 924844291 1:247749919-247749941 CCTTGTTTCCAGGCTGACTCTCA No data
Right 924844296 1:247749949-247749971 TGGTCTAGGCTAGCCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924844296 Original CRISPR TGGTCTAGGCTAGCCCCTCA TGG Intergenic