ID: 924846151

View in Genome Browser
Species Human (GRCh38)
Location 1:247774270-247774292
Sequence TGAGCCTGCTAACATATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924846149_924846151 -8 Left 924846149 1:247774255-247774277 CCTCCAAAAGAAACATGAGCCTG No data
Right 924846151 1:247774270-247774292 TGAGCCTGCTAACATATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924846151 Original CRISPR TGAGCCTGCTAACATATTAT AGG Intergenic
No off target data available for this crispr