ID: 924846154

View in Genome Browser
Species Human (GRCh38)
Location 1:247774304-247774326
Sequence TACTCTGCACTTTTGTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924846149_924846154 26 Left 924846149 1:247774255-247774277 CCTCCAAAAGAAACATGAGCCTG No data
Right 924846154 1:247774304-247774326 TACTCTGCACTTTTGTCCTCTGG No data
924846152_924846154 7 Left 924846152 1:247774274-247774296 CCTGCTAACATATTATAGGCCTT No data
Right 924846154 1:247774304-247774326 TACTCTGCACTTTTGTCCTCTGG No data
924846150_924846154 23 Left 924846150 1:247774258-247774280 CCAAAAGAAACATGAGCCTGCTA No data
Right 924846154 1:247774304-247774326 TACTCTGCACTTTTGTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924846154 Original CRISPR TACTCTGCACTTTTGTCCTC TGG Intergenic
No off target data available for this crispr