ID: 924854807

View in Genome Browser
Species Human (GRCh38)
Location 1:247865581-247865603
Sequence TAATCCCTCCTCGCCATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924854807_924854812 15 Left 924854807 1:247865581-247865603 CCAGGCATGGCGAGGAGGGATTA No data
Right 924854812 1:247865619-247865641 AGCTTCCTCCCAGTCTGTTTGGG 0: 1
1: 0
2: 3
3: 13
4: 152
924854807_924854811 14 Left 924854807 1:247865581-247865603 CCAGGCATGGCGAGGAGGGATTA No data
Right 924854811 1:247865618-247865640 CAGCTTCCTCCCAGTCTGTTTGG 0: 1
1: 0
2: 0
3: 19
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924854807 Original CRISPR TAATCCCTCCTCGCCATGCC TGG (reversed) Intronic
No off target data available for this crispr