ID: 924856541

View in Genome Browser
Species Human (GRCh38)
Location 1:247880058-247880080
Sequence CCACATACAAACCAGCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924856541_924856545 26 Left 924856541 1:247880058-247880080 CCCCAATGCTGGTTTGTATGTGG 0: 1
1: 0
2: 0
3: 8
4: 154
Right 924856545 1:247880107-247880129 TGAATAAATGATTGACTATGTGG 0: 1
1: 0
2: 4
3: 58
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924856541 Original CRISPR CCACATACAAACCAGCATTG GGG (reversed) Intergenic
900554546 1:3273207-3273229 CAACAAAGAAACCAGCGTTGGGG - Intronic
901163830 1:7200607-7200629 CCTCAGACAAACCAGAACTGAGG - Intronic
902755321 1:18545609-18545631 CCACAGACAGGCCAGCCTTGGGG + Intergenic
902974311 1:20078021-20078043 CCACAAACACACCTGCATTTGGG + Intronic
910762823 1:90751634-90751656 CTACATAATAAACAGCATTGGGG + Intergenic
917188822 1:172391473-172391495 CCAAATACAAGCCAGAAATGGGG + Intronic
918386476 1:184013324-184013346 AAACAAACAAAACAGCATTGTGG + Intronic
922201414 1:223404546-223404568 CCACATAGGAACCAGTAATGAGG + Intergenic
923713503 1:236405655-236405677 CCACAAAAAAAGCATCATTGAGG - Intronic
924355346 1:243168365-243168387 CCACATACAAAATCTCATTGAGG + Intronic
924856541 1:247880058-247880080 CCACATACAAACCAGCATTGGGG - Intergenic
1062989390 10:1801599-1801621 CCACAGACAAACCCTCACTGGGG - Intergenic
1070209285 10:74298769-74298791 ACAAAAACAAACCAGAATTGAGG + Intronic
1070857937 10:79622706-79622728 ACAAAAACAAACCAGCAATGAGG + Intergenic
1073505890 10:103989367-103989389 CCACATCCTCACCAGCATTTGGG - Intronic
1074022646 10:109599865-109599887 ACCCAAACAAACCAGCATTGGGG + Intergenic
1074738416 10:116460101-116460123 CCACATATAACCCAGTCTTGCGG - Intronic
1077031068 11:467834-467856 CCACATAAAAACCTGCATGCAGG + Intronic
1078833248 11:14997040-14997062 CCTCATACAAACAAGCAATAGGG + Intronic
1085598351 11:77831182-77831204 CCAATTTCAAACCATCATTGTGG - Intronic
1088253430 11:107881202-107881224 CCACAGACAGAGCAGCTTTGAGG + Intronic
1088768694 11:113011604-113011626 CCACATCCTCTCCAGCATTGGGG + Intronic
1093118747 12:15242723-15242745 CCAAATACAAAACAGCTTGGGGG + Intronic
1093484517 12:19639024-19639046 CAACCTACATACCAGCATTTGGG + Intronic
1098316084 12:69194600-69194622 CCACAAACAGAGCAGCCTTGAGG - Intergenic
1098940928 12:76534662-76534684 ACACATACACACAAGCAATGAGG + Intronic
1100071185 12:90720604-90720626 ACACACACAAACTAGAATTGGGG + Intergenic
1102376582 12:112426710-112426732 ACACACACAAACCAGCACTTGGG - Intronic
1104262765 12:127199600-127199622 TCACATACAAACCAGTTCTGGGG + Intergenic
1106510306 13:30407444-30407466 CATCATACAAACCAAAATTGGGG - Intergenic
1106907751 13:34426376-34426398 CCACAAACAAAACAGGTTTGTGG + Intergenic
1108900873 13:55406645-55406667 CCACAGACATAGCAGCCTTGAGG - Intergenic
1109534762 13:63700908-63700930 CCAAATACAGACCTGCACTGGGG - Intergenic
1112686446 13:101833319-101833341 GCACATACAAAAGAGCAATGAGG - Intronic
1113448816 13:110391170-110391192 CCACAGCCAATCCAGCATTCTGG - Intronic
1114029237 14:18561296-18561318 CAACAAACAAACAAGCAATGAGG + Intergenic
1114543399 14:23480659-23480681 CCACAAAGAGACCAGAATTGTGG - Intronic
1115651858 14:35408196-35408218 CAAAATACAAAGCAGCTTTGAGG - Intergenic
1116202519 14:41816481-41816503 CCTCAGACAAACAAACATTGAGG - Intronic
1118648647 14:67866567-67866589 CCACATACAAAACAGAGTTTAGG + Intronic
1121789075 14:96685320-96685342 CAAAATACAACCCAGCATGGGGG + Intergenic
1124680706 15:31728273-31728295 CCACCTTCAAAATAGCATTGAGG + Intronic
1125122169 15:36174443-36174465 CCAGATACAAAACAGTAATGAGG - Intergenic
1126557992 15:50011444-50011466 CTACCTACAAACCAGCACTGAGG + Intronic
1130342407 15:83010976-83010998 CCACAGGCAAATCAGCATTGGGG + Intronic
1131955292 15:97729051-97729073 CCACTGACAGACCTGCATTGGGG + Intergenic
1134867221 16:17619326-17619348 CCACATACCACGCACCATTGTGG + Intergenic
1136032312 16:27512536-27512558 CTACAAAAAAACCAGCAATGGGG + Intronic
1137290852 16:47051022-47051044 CCACATACACACCTGCAAGGAGG + Intergenic
1137566288 16:49534613-49534635 GCACATACAAACCCGCTGTGGGG + Intronic
1138032328 16:53569605-53569627 CCACAGACAAAGCAGCCCTGTGG - Intergenic
1138032935 16:53575237-53575259 CCACATCCTCACCAGCATTTGGG + Intergenic
1140165695 16:72548402-72548424 CCTGATAAAAACCAGCAATGGGG + Intergenic
1143422946 17:6810129-6810151 CCACATCCTCACCAGCATTTGGG + Intronic
1146156080 17:30524726-30524748 CCACATATAAAAAGGCATTGAGG + Exonic
1149017725 17:51927988-51928010 CTACATACAACCCAGCCTTAAGG + Intronic
1157068632 18:44380532-44380554 CCACATCCTCACCAGCATTACGG - Intergenic
1158804978 18:60960276-60960298 CCATATACAAAGCAGCAATTTGG + Intergenic
1160116226 18:76081884-76081906 CCACTTTCACACCAGCATTGGGG - Intergenic
1161107204 19:2450186-2450208 CAACACACAAACCCCCATTGAGG + Intronic
1161932217 19:7348733-7348755 CCAGACACACACCAGCATGGTGG - Intergenic
1166250953 19:41570526-41570548 CCACAGACAACTCAGCAGTGGGG + Intronic
1166514510 19:43436395-43436417 CCACATACATACCTGCCTCGAGG + Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1167679598 19:50911043-50911065 CCACCCACAAACAAGCATGGAGG + Intergenic
927036857 2:19187059-19187081 CCATTTCTAAACCAGCATTGTGG + Intergenic
927425416 2:22975895-22975917 GTACATACAAACCACCATTCTGG + Intergenic
933763417 2:85691120-85691142 CCACAGACACATCAGCATTTGGG + Intronic
933921067 2:87046227-87046249 ACACATTCAAATCAGCATTAGGG + Intergenic
934001899 2:87723358-87723380 ACACATTCAAATCAGCATTAGGG - Intergenic
936362561 2:111817879-111817901 ACACATTCAAATCAGCATTAGGG + Intronic
936779159 2:116011456-116011478 CCACAGCCTCACCAGCATTGTGG + Intergenic
938077805 2:128349607-128349629 CCACATAGACACCGGCATGGAGG - Intergenic
939625840 2:144476264-144476286 CCACAGCCATACCACCATTGGGG - Intronic
939752746 2:146067756-146067778 ACACACACATTCCAGCATTGAGG - Intergenic
940417655 2:153441212-153441234 CCTGATACAAACAAGCAATGAGG - Intergenic
940905296 2:159163630-159163652 CCAGATACAAGCCAGCTTCGTGG + Intronic
942486581 2:176446097-176446119 CACCATTCCAACCAGCATTGTGG - Intergenic
943145540 2:184039919-184039941 CCAGATACAAATCAGGATTCTGG - Intergenic
943965339 2:194325931-194325953 CCAGATAAAAACCTGCATTAAGG - Intergenic
948573561 2:238934905-238934927 CCACATTCCCACCAGCATTTAGG - Intergenic
1168838274 20:892293-892315 ACACATACAAAAAAGCATAGAGG + Intronic
1171964875 20:31522153-31522175 TCACCTACAAACCAGCATTATGG - Intronic
1176177865 20:63737209-63737231 CCAGATAGTAACCAGCATCGGGG - Intronic
1178026146 21:28470199-28470221 CCATATACAGACCAATATTGAGG + Intergenic
1180453353 22:15488359-15488381 CAACAAACAAACAAGCAATGAGG + Intergenic
1181336236 22:22132147-22132169 CCACATACATACCAGGATCTGGG - Intergenic
1184284902 22:43465014-43465036 CCACATACACACCTGCCTGGAGG + Intronic
1184741055 22:46429314-46429336 ACACCTTCAAACCAGCCTTGAGG + Intronic
1184927684 22:47655275-47655297 CCCCAGACAACCCAGCATAGAGG - Intergenic
1185205745 22:49537065-49537087 CCGCATGGAAACCAGCACTGAGG - Intronic
952303332 3:32123950-32123972 TCACATGCAAACCACCTTTGTGG + Intronic
953270208 3:41434981-41435003 CCACATTCCAAACAGCTTTGTGG + Intronic
953608157 3:44425125-44425147 CCAAAGACTAACCAGCATTCAGG - Intergenic
953792975 3:45962567-45962589 CCACATACAAAGGGGCATTCTGG + Intronic
953812014 3:46120903-46120925 CCACATTCAAACAGGCACTGAGG - Intergenic
955702513 3:61696140-61696162 GCACAAACATACAAGCATTGGGG - Intronic
956256589 3:67289967-67289989 ACACATTCAAACCAGAATAGGGG - Intergenic
957698655 3:83679982-83680004 CCTCACAAAAACCAGCAATGGGG + Intergenic
964707911 3:159640367-159640389 CCACACTCAGACCTGCATTGTGG - Intronic
965019764 3:163213895-163213917 ACACATACAAACCTTCTTTGAGG + Intergenic
965381385 3:167993352-167993374 CCATATAGAAAACAGCATAGAGG + Intergenic
965705164 3:171499328-171499350 CAAAATACAAAGCAGCATTTTGG + Intergenic
972473003 4:39424927-39424949 CAACATATAAACCACCATGGAGG - Intronic
973331861 4:48917475-48917497 CCACATCCTCACCAGCATTTGGG + Intergenic
974170337 4:58258757-58258779 TCCCATATAAACAAGCATTGTGG + Intergenic
975143762 4:70944888-70944910 CCAAACACCTACCAGCATTGGGG + Intronic
975501943 4:75096268-75096290 CCTGATACAAACAAGCAATGGGG - Intergenic
980639475 4:135557005-135557027 CCATATATTAAACAGCATTGTGG + Intergenic
987820107 5:22953121-22953143 ACACATACACACAAGCATTCAGG - Intergenic
991951563 5:71951490-71951512 CCTGACACAAACCAGCAATGGGG - Intergenic
992368105 5:76113946-76113968 ACACATACACACCAGGCTTGTGG + Intronic
992846222 5:80751395-80751417 CCCGATACAAACAAGCAATGGGG + Intronic
994001675 5:94788778-94788800 CCACCCTCAAACCAGAATTGTGG + Intronic
995003449 5:107162670-107162692 CCTCATAAAAACAAGCAATGGGG + Intergenic
995770123 5:115660382-115660404 CCGCATACAATTCAGCATTCTGG + Intergenic
998826641 5:146108170-146108192 CCACATACAAAAAAGAATTCAGG + Intergenic
999965405 5:156804259-156804281 CCACAGACAAAGCAGCCCTGAGG + Intergenic
1000126314 5:158247278-158247300 CCACAAACAAACCAACATCCGGG - Intergenic
1003389756 6:5703615-5703637 CCACACACAGACCAGATTTGGGG + Intronic
1008091616 6:47299452-47299474 CCACCTACACACCAGCCTGGGGG + Intronic
1008467809 6:51850158-51850180 CCTCATAAAAACAAGCAATGGGG - Intronic
1010368214 6:75077409-75077431 CTACCTACATAACAGCATTGTGG + Intergenic
1010888440 6:81272905-81272927 CCACATGGAAAACAGTATTGAGG + Intergenic
1012884526 6:104830814-104830836 CCACAAACAGACCAGCATGGGGG + Intronic
1014181640 6:118390804-118390826 CCACAAACAAACCTCCATGGAGG - Intergenic
1015845184 6:137513089-137513111 CCACATACAAAGAAGCACTTGGG - Intergenic
1015995118 6:138988702-138988724 CCACGTAGACACCAACATTGAGG + Intergenic
1016111916 6:140234968-140234990 CCAGACACAAACAAGCAATGGGG + Intergenic
1016565961 6:145454368-145454390 CAAGATAAAAACCAGCTTTGGGG - Intergenic
1018641535 6:165908515-165908537 CCACATACAATCCAGCACGGGGG + Intronic
1023114790 7:36851987-36852009 ACAGATACAAAACAGCCTTGTGG - Intergenic
1024915206 7:54491695-54491717 CCACAAACAAAACAGAAATGTGG - Intergenic
1024945694 7:54805489-54805511 GCACACACACACCAGCAATGAGG + Intergenic
1028049325 7:86162252-86162274 CCTAATACAAACAAGCAATGGGG + Intergenic
1029970524 7:104784320-104784342 CCAGATCCCAACCAGCAGTGTGG + Intronic
1030114075 7:106050074-106050096 CCACATGCTCCCCAGCATTGAGG - Intergenic
1031564739 7:123281735-123281757 CCACAGACAAATGTGCATTGAGG - Intergenic
1031930239 7:127678142-127678164 ACACATACAAACAAGCATTTGGG - Intronic
1033533950 7:142294700-142294722 CCACGTACATACCGGCTTTGAGG - Intergenic
1044362121 8:91298767-91298789 ACACATACATAGCAGCATTAGGG - Intronic
1048785277 8:138043843-138043865 CCTGAGAAAAACCAGCATTGGGG - Intergenic
1051547584 9:18293681-18293703 CCACATACAATCCTGCAGAGGGG - Intergenic
1055902895 9:81261633-81261655 CCAGATAAAAACAAGCAATGGGG + Intergenic
1056582456 9:87902050-87902072 CCAAAAAAAATCCAGCATTGGGG + Intergenic
1058037270 9:100266347-100266369 CCAGAGACAAAGCAGCCTTGAGG + Intronic
1059220673 9:112614889-112614911 CAACATCCACACCAGCATTCTGG + Intronic
1061109330 9:128556720-128556742 CCACATTCCAATCAGGATTGTGG - Intronic
1061829005 9:133278687-133278709 ACACATGCAAACCAGAATGGAGG - Intergenic
1186458385 X:9728871-9728893 CCACACACACACAAGCACTGTGG + Intronic
1188155086 X:26731879-26731901 CCTGATACAAACAAGCAATGGGG - Intergenic
1192017393 X:67346579-67346601 CCAGACACAAAGCAGCCTTGAGG + Intergenic
1192128538 X:68525749-68525771 CCTGATAAAAACCAGCAATGGGG - Intronic
1194022072 X:88703223-88703245 CCCCATAAAAACAAGCAATGGGG + Intergenic
1194184241 X:90752954-90752976 CCACATACAAACTTCCATTTTGG - Intergenic
1194824318 X:98542403-98542425 CCACATAAAAACCTACAATGTGG - Intergenic
1195414667 X:104607115-104607137 CCTGACACAAACCAGCAATGGGG + Intronic
1195811966 X:108844069-108844091 CCAGATAAAAACAAGCAATGCGG - Intergenic
1196736141 X:118982444-118982466 CCACATGCTAACCAGCTTTCAGG - Intronic
1199267433 X:145844844-145844866 ACAAATACGAACCAGCATGGGGG - Intergenic
1200530832 Y:4334880-4334902 CCACATACAAACTTCCATTTTGG - Intergenic
1201614485 Y:15882033-15882055 CCACATCCTCACCAGCATTTGGG + Intergenic
1201615883 Y:15897742-15897764 CCACATCCTCACCAGCATTTGGG - Intergenic