ID: 924856965

View in Genome Browser
Species Human (GRCh38)
Location 1:247883510-247883532
Sequence CACTTGGATTTCCTTACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924856956_924856965 29 Left 924856956 1:247883458-247883480 CCAATACTGTGGGCCATTGCATT No data
Right 924856965 1:247883510-247883532 CACTTGGATTTCCTTACGCCTGG No data
924856962_924856965 -7 Left 924856962 1:247883494-247883516 CCAAGCCTGAGAGAGGCACTTGG No data
Right 924856965 1:247883510-247883532 CACTTGGATTTCCTTACGCCTGG No data
924856959_924856965 16 Left 924856959 1:247883471-247883493 CCATTGCATTTATAAGGAATGGG No data
Right 924856965 1:247883510-247883532 CACTTGGATTTCCTTACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924856965 Original CRISPR CACTTGGATTTCCTTACGCC TGG Intergenic
No off target data available for this crispr