ID: 924860104

View in Genome Browser
Species Human (GRCh38)
Location 1:247911593-247911615
Sequence CCCCGTGGATATTACAGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924860104_924860113 12 Left 924860104 1:247911593-247911615 CCGCCTCTGTAATATCCACGGGG No data
Right 924860113 1:247911628-247911650 ACAATTCCCACTATCGAAGGGGG No data
924860104_924860110 9 Left 924860104 1:247911593-247911615 CCGCCTCTGTAATATCCACGGGG No data
Right 924860110 1:247911625-247911647 GATACAATTCCCACTATCGAAGG No data
924860104_924860112 11 Left 924860104 1:247911593-247911615 CCGCCTCTGTAATATCCACGGGG No data
Right 924860112 1:247911627-247911649 TACAATTCCCACTATCGAAGGGG No data
924860104_924860111 10 Left 924860104 1:247911593-247911615 CCGCCTCTGTAATATCCACGGGG No data
Right 924860111 1:247911626-247911648 ATACAATTCCCACTATCGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924860104 Original CRISPR CCCCGTGGATATTACAGAGG CGG (reversed) Intergenic
No off target data available for this crispr