ID: 924860107

View in Genome Browser
Species Human (GRCh38)
Location 1:247911596-247911618
Sequence TTCCCCCGTGGATATTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924860107_924860112 8 Left 924860107 1:247911596-247911618 CCTCTGTAATATCCACGGGGGAA No data
Right 924860112 1:247911627-247911649 TACAATTCCCACTATCGAAGGGG No data
924860107_924860111 7 Left 924860107 1:247911596-247911618 CCTCTGTAATATCCACGGGGGAA No data
Right 924860111 1:247911626-247911648 ATACAATTCCCACTATCGAAGGG No data
924860107_924860113 9 Left 924860107 1:247911596-247911618 CCTCTGTAATATCCACGGGGGAA No data
Right 924860113 1:247911628-247911650 ACAATTCCCACTATCGAAGGGGG No data
924860107_924860110 6 Left 924860107 1:247911596-247911618 CCTCTGTAATATCCACGGGGGAA No data
Right 924860110 1:247911625-247911647 GATACAATTCCCACTATCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924860107 Original CRISPR TTCCCCCGTGGATATTACAG AGG (reversed) Intergenic