ID: 924860109

View in Genome Browser
Species Human (GRCh38)
Location 1:247911608-247911630
Sequence TGTATCATCCTTTTCCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924860109_924860110 -6 Left 924860109 1:247911608-247911630 CCACGGGGGAAAAGGATGATACA No data
Right 924860110 1:247911625-247911647 GATACAATTCCCACTATCGAAGG No data
924860109_924860111 -5 Left 924860109 1:247911608-247911630 CCACGGGGGAAAAGGATGATACA No data
Right 924860111 1:247911626-247911648 ATACAATTCCCACTATCGAAGGG No data
924860109_924860112 -4 Left 924860109 1:247911608-247911630 CCACGGGGGAAAAGGATGATACA No data
Right 924860112 1:247911627-247911649 TACAATTCCCACTATCGAAGGGG No data
924860109_924860113 -3 Left 924860109 1:247911608-247911630 CCACGGGGGAAAAGGATGATACA No data
Right 924860113 1:247911628-247911650 ACAATTCCCACTATCGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924860109 Original CRISPR TGTATCATCCTTTTCCCCCG TGG (reversed) Intergenic
No off target data available for this crispr