ID: 924860110

View in Genome Browser
Species Human (GRCh38)
Location 1:247911625-247911647
Sequence GATACAATTCCCACTATCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924860104_924860110 9 Left 924860104 1:247911593-247911615 CCGCCTCTGTAATATCCACGGGG No data
Right 924860110 1:247911625-247911647 GATACAATTCCCACTATCGAAGG No data
924860107_924860110 6 Left 924860107 1:247911596-247911618 CCTCTGTAATATCCACGGGGGAA No data
Right 924860110 1:247911625-247911647 GATACAATTCCCACTATCGAAGG No data
924860109_924860110 -6 Left 924860109 1:247911608-247911630 CCACGGGGGAAAAGGATGATACA No data
Right 924860110 1:247911625-247911647 GATACAATTCCCACTATCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924860110 Original CRISPR GATACAATTCCCACTATCGA AGG Intergenic
No off target data available for this crispr