ID: 924860113

View in Genome Browser
Species Human (GRCh38)
Location 1:247911628-247911650
Sequence ACAATTCCCACTATCGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924860104_924860113 12 Left 924860104 1:247911593-247911615 CCGCCTCTGTAATATCCACGGGG No data
Right 924860113 1:247911628-247911650 ACAATTCCCACTATCGAAGGGGG No data
924860109_924860113 -3 Left 924860109 1:247911608-247911630 CCACGGGGGAAAAGGATGATACA No data
Right 924860113 1:247911628-247911650 ACAATTCCCACTATCGAAGGGGG No data
924860107_924860113 9 Left 924860107 1:247911596-247911618 CCTCTGTAATATCCACGGGGGAA No data
Right 924860113 1:247911628-247911650 ACAATTCCCACTATCGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924860113 Original CRISPR ACAATTCCCACTATCGAAGG GGG Intergenic
No off target data available for this crispr