ID: 924866518

View in Genome Browser
Species Human (GRCh38)
Location 1:247987790-247987812
Sequence TGGGAGAAGGGTAATGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924866518_924866524 20 Left 924866518 1:247987790-247987812 CCAAACTCATTACCCTTCTCCCA 0: 1
1: 0
2: 3
3: 36
4: 333
Right 924866524 1:247987833-247987855 TCCAATTTATGTCTGCAGCAAGG 0: 1
1: 0
2: 2
3: 10
4: 133
924866518_924866527 22 Left 924866518 1:247987790-247987812 CCAAACTCATTACCCTTCTCCCA 0: 1
1: 0
2: 3
3: 36
4: 333
Right 924866527 1:247987835-247987857 CAATTTATGTCTGCAGCAAGGGG 0: 1
1: 0
2: 1
3: 19
4: 161
924866518_924866526 21 Left 924866518 1:247987790-247987812 CCAAACTCATTACCCTTCTCCCA 0: 1
1: 0
2: 3
3: 36
4: 333
Right 924866526 1:247987834-247987856 CCAATTTATGTCTGCAGCAAGGG 0: 1
1: 0
2: 2
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924866518 Original CRISPR TGGGAGAAGGGTAATGAGTT TGG (reversed) Intronic
900643031 1:3696337-3696359 TGTGAGGTGGGTAAGGAGTTGGG + Intronic
901140543 1:7026418-7026440 TGGGAGAAGGGAAATGACTCAGG + Intronic
901757833 1:11452099-11452121 TGGGAGGAGGATGATGAATTTGG + Intergenic
902388306 1:16088556-16088578 TAGGAGAAGAGGAACGAGTTTGG + Intergenic
903573953 1:24326314-24326336 AGGGAGAATGGAGATGAGTTGGG - Intronic
903802004 1:25975971-25975993 TGGGAGGAGCGTAGTGAGTGAGG - Intronic
904576055 1:31505744-31505766 TGGCATAAGTGTAATCAGTTGGG + Intergenic
906138160 1:43515084-43515106 TGGGAGAACGGGAATGAGAAGGG - Intergenic
907535498 1:55151833-55151855 AGAGGGAAGGGTAATCAGTTGGG + Intronic
907599368 1:55751076-55751098 AGAGAAAGGGGTAATGAGTTAGG + Intergenic
908934460 1:69357693-69357715 TAGGAGAGGGGAAATGAATTTGG + Intergenic
909971381 1:81994972-81994994 TGAGTGAATGGTAATGGGTTTGG + Intergenic
910313164 1:85851072-85851094 GGGAAAAAGGGTGATGAGTTTGG - Intronic
911902959 1:103528253-103528275 TGGGAGAGAGGTATTGAGTTTGG + Intronic
911997213 1:104781389-104781411 TTGGTGAAAGGTAATGAGTTTGG - Intergenic
912137874 1:106683315-106683337 TGGGAGCAGGAGAAAGAGTTTGG - Intergenic
912727630 1:112072790-112072812 AGGGAGATGGGTAATGACTAAGG + Intergenic
912811600 1:112799247-112799269 TGGGAGAAGGGGCAAGAGTGAGG - Intergenic
913314266 1:117536792-117536814 TGGGAGAAGGGACACCAGTTTGG + Intergenic
914882188 1:151555986-151556008 GGGGAGGAGGGAAATGAGTGTGG - Intronic
915362790 1:155295815-155295837 TCTGAGAATGGTAATGGGTTGGG - Intronic
915727983 1:158032325-158032347 TGGGAGCAGGGAGATGAGGTTGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915976684 1:160395664-160395686 CTGGAGAAGGCGAATGAGTTGGG + Intergenic
915996749 1:160571582-160571604 TGAAAGAAGGGTGATGAGATAGG + Intronic
916492421 1:165313684-165313706 AGGCAGAAGGGAAATGAGCTGGG - Intronic
917013994 1:170508771-170508793 GGGGAGAAGGGTAAGGGGGTGGG - Intergenic
917640366 1:176977891-176977913 TGGCTGAAGGCTAATGACTTGGG + Intronic
918322212 1:183375104-183375126 TGGGGGTAGGGGCATGAGTTAGG - Intronic
919752692 1:201048155-201048177 TGGGAGCAGGGGAAGGAGTCAGG - Intronic
920397887 1:205659857-205659879 TGGGAGAAGGGTAACGGGGTAGG + Intronic
921882438 1:220270710-220270732 TGGAAGAAGGGAAATGGATTGGG - Intronic
923474472 1:234319855-234319877 TTGAAGAAGGGAAATAAGTTTGG - Intronic
923830281 1:237548333-237548355 TGGAAGAACAGTAATGAGGTAGG + Intronic
924122373 1:240814188-240814210 AGGGAGAAGGGAAAGAAGTTGGG + Intronic
924216219 1:241824893-241824915 TGGGAGAGGGGTAAGGACCTAGG + Intergenic
924256258 1:242185980-242186002 TAGGACATGGGTAATGAATTGGG - Intronic
924863067 1:247946747-247946769 TGGGAGAAGGGTAAGGAACCTGG - Intronic
924866518 1:247987790-247987812 TGGGAGAAGGGTAATGAGTTTGG - Intronic
924870329 1:248035791-248035813 TGGGAGAAAGGTAATGAGTGTGG - Intronic
1063889080 10:10610999-10611021 GGGGATGAGGCTAATGAGTTTGG + Intergenic
1063939372 10:11110964-11110986 TGGGAGAAGGGTTATAAGGTTGG + Intronic
1067016155 10:42757479-42757501 TGGAAGAGGGGGAATTAGTTGGG + Intergenic
1067179930 10:43977454-43977476 TGGGAGAAGGGTAAGGATGGAGG + Intergenic
1067354979 10:45515895-45515917 TGGGAGAAGAGAACAGAGTTAGG - Intronic
1068032270 10:51718461-51718483 TGTCAGAAGGCTAAGGAGTTTGG + Intronic
1068431717 10:56941609-56941631 TGGGGGAGCAGTAATGAGTTGGG - Intergenic
1070085797 10:73236088-73236110 TGGTTCAAGGGTCATGAGTTGGG - Intronic
1071203533 10:83248452-83248474 TGGGGCAAGGGTAGTGAGTAGGG - Intergenic
1072262259 10:93690220-93690242 TGGGGGGAAGATAATGAGTTTGG - Intronic
1073096670 10:100984226-100984248 TGGGAGAAGGGTATGGAGTGGGG - Exonic
1073259016 10:102174658-102174680 AGTGGGAAGGGGAATGAGTTGGG - Intergenic
1073955986 10:108872014-108872036 TGGGAGGAACGTAATGCGTTTGG + Intergenic
1074681838 10:115914754-115914776 TGAGATAAGGGAAATGAGTATGG + Intronic
1075016929 10:118916708-118916730 TAGGAAAAGGGTAAAGAATTGGG - Intergenic
1075070386 10:119316330-119316352 TGGGAGATGGGTAGTGAGCTGGG + Intronic
1076340501 10:129742020-129742042 TGGGGGAAGGATAATGATTGGGG + Intronic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1080583085 11:33659206-33659228 TGAGAGAAGGGGAATGAAATGGG - Intronic
1082743296 11:56935274-56935296 TGGGTGAGAGATAATGAGTTTGG + Intergenic
1082759105 11:57109246-57109268 TAAGAGAAGGGAAATGAGTGAGG - Intergenic
1083356409 11:62069522-62069544 TCGAAGCAGGGAAATGAGTTAGG + Intergenic
1083816793 11:65137292-65137314 TGGGAGCAGGGAAACCAGTTAGG + Intergenic
1084584722 11:70051178-70051200 TGGGTGCAGGGTAATGACTGGGG - Intergenic
1084915516 11:72426201-72426223 TGGGAGAAGGGAGATGGGTAGGG + Intronic
1085073209 11:73567331-73567353 AGGGAAAAGGATAACGAGTTCGG + Intronic
1086115210 11:83242335-83242357 TGGAAGCAGGGAAATCAGTTAGG + Intronic
1087209693 11:95434472-95434494 AGGGAGAAGGGTTATCAGATGGG - Intergenic
1088349034 11:108864277-108864299 TGGGAGAAGGGTAAGGATGGAGG - Intronic
1088592124 11:111412902-111412924 GGGGAGAAGGAAAATGGGTTGGG + Intronic
1088802319 11:113317414-113317436 TGGATGCAGGGTTATGAGTTGGG - Intronic
1089035854 11:115390356-115390378 AGGGAGAAGGGGAAAGGGTTGGG + Intronic
1089762677 11:120739919-120739941 TAGGGCAAGGGTAATGGGTTTGG - Intronic
1090713068 11:129405316-129405338 TAGCAGAAAGGTGATGAGTTTGG - Intronic
1092492683 12:8960122-8960144 TGAGAGGAGGGGAATAAGTTAGG + Intronic
1093357028 12:18178597-18178619 TAGGAGAAAGGAAATGAATTTGG - Intronic
1094294377 12:28888082-28888104 TGGAAGAAGGGAACTGAGGTGGG - Intergenic
1095480236 12:42627095-42627117 TGGGAGCAGGGTTCTCAGTTGGG + Intergenic
1096113512 12:49042160-49042182 TGGGAGAAGGATGAGGAGTTGGG - Exonic
1096498032 12:52050035-52050057 TGGGAGAAGGGGAATGGATGGGG + Intronic
1096690226 12:53316017-53316039 TGTGAGCAGGTTAAGGAGTTGGG + Intronic
1097276430 12:57816596-57816618 TGAGAGAAGGCAACTGAGTTTGG - Intronic
1098992540 12:77079676-77079698 TGGCAGAAGGGTAAAGAGAGAGG + Intergenic
1099670935 12:85691134-85691156 TGGAAGAAGGTTCATCAGTTAGG + Intergenic
1099964686 12:89433194-89433216 TGGGAGAAGAGCAATGAGACAGG + Intronic
1100173375 12:92002680-92002702 AGGGAGAATTGGAATGAGTTGGG - Intronic
1101120078 12:101570303-101570325 TGGGATAAGGGGAATGAGAGAGG - Intronic
1101449814 12:104765852-104765874 TGGGAGAAGAGTAAGGGCTTTGG + Intergenic
1101833514 12:108278227-108278249 TGGAAGAAGGGGAATGGGTTAGG - Intergenic
1104532619 12:129586645-129586667 TGGGAGATGGGTTATGAGGGTGG - Intronic
1104577410 12:129980456-129980478 TGGGAGATGGGACATGATTTAGG - Intergenic
1106048664 13:26169312-26169334 AGGGAGAAGGGCAAGGAGTAGGG + Intronic
1106719296 13:32422290-32422312 TCGTGAAAGGGTAATGAGTTTGG - Intronic
1106995358 13:35475017-35475039 TTTGAGAAGGGTAATAATTTCGG + Exonic
1108439778 13:50439054-50439076 TGAGAGAAGGGAAATGAATGGGG + Intronic
1110286175 13:73752696-73752718 AGGGAGCAGGGGAATGAGTGAGG - Intronic
1114069311 14:19095321-19095343 TGGAGGAGGGGGAATGAGTTGGG - Intergenic
1114092950 14:19304681-19304703 TGGAGGAGGGGGAATGAGTTGGG + Intergenic
1114827844 14:26103383-26103405 TAGGAAAAGTGTCATGAGTTGGG - Intergenic
1115896248 14:38090978-38091000 CATGAGAAGAGTAATGAGTTTGG + Intergenic
1115905765 14:38201484-38201506 TGGCAGATGAGTAATGAGCTTGG - Intergenic
1117492000 14:56257720-56257742 TGAGAGAAGGGAAATAAGTGAGG + Intronic
1117633031 14:57713201-57713223 TGAAAGCAGGGAAATGAGTTGGG - Intronic
1118106925 14:62670132-62670154 TGGGAGAAGAGTAAAGGATTGGG + Intergenic
1119013515 14:71022592-71022614 TGGGAGAAAAGTCATGAGTAGGG + Intronic
1120152130 14:81048165-81048187 AGGAAGTAGGGTGATGAGTTGGG - Intronic
1120241640 14:81956535-81956557 TGGGAGGGGGGTAATGAGTTTGG + Intergenic
1120631927 14:86902168-86902190 TGGAAGCAGGGAAGTGAGTTAGG + Intergenic
1121695846 14:95911257-95911279 TGGGAGAAGGGCAACGAGGCAGG - Intergenic
1123842984 15:24268277-24268299 TGGGGGAAGGCTAGTGAGTTGGG - Intergenic
1123858022 15:24434349-24434371 TGGGGGAAGGCCAGTGAGTTGGG - Intergenic
1123862653 15:24484811-24484833 TGGGGGAAGGCCAGTGAGTTTGG - Intergenic
1125433064 15:39616834-39616856 TGGGAGAAGGGTTATGGCATTGG + Intronic
1125824911 15:42668025-42668047 TGCAAGAATGCTAATGAGTTTGG - Intronic
1127859909 15:62985278-62985300 TTTGTGAAGGGTAATGAGGTGGG - Intergenic
1128053382 15:64682516-64682538 AGGGAAAAGGGCAAGGAGTTGGG - Exonic
1128056278 15:64702493-64702515 TGGGGGGAGGGTGATGAGTGGGG + Intronic
1129001810 15:72341661-72341683 TAGGTGAAGGGAGATGAGTTGGG + Exonic
1129120606 15:73394171-73394193 TGGGAGTAGGGTAATGAGTGTGG + Intergenic
1129652264 15:77499477-77499499 TGGGAGCAGGGTAAAGAGCTGGG - Intergenic
1130922103 15:88356187-88356209 TGGAAGGAGGGAAATAAGTTGGG + Intergenic
1131773101 15:95762403-95762425 TGGAAGACAGATAATGAGTTTGG - Intergenic
1131824095 15:96303489-96303511 TGGGACAAGGATAAAGAGTGTGG + Intergenic
1133619329 16:7511334-7511356 TGGGAGAAGGGCAATGTCTTGGG + Intronic
1133634369 16:7651897-7651919 TGGGACAAGCGTAGTGAGTATGG + Intronic
1134161633 16:11895109-11895131 AAGGAGAAGGGTAATGAACTAGG - Intronic
1134874696 16:17687468-17687490 TGGGAAAATGGAAATGAATTTGG + Intergenic
1135309117 16:21391625-21391647 AGGGGGAAGGGTGAAGAGTTAGG - Intergenic
1136125275 16:28175066-28175088 TGAAAGAAGGGGAATGAATTTGG - Intronic
1136148699 16:28331951-28331973 AGGGGGAAGGGTGAAGAGTTAGG - Intergenic
1136305861 16:29370756-29370778 AGGGGGAAGGGTGAAGAGTTAGG - Intergenic
1137847684 16:51708081-51708103 TGGGAGATGGGAAATAAATTAGG - Intergenic
1140252562 16:73306900-73306922 TGAGAGAAGGGTATAGAGTTAGG + Intergenic
1143614229 17:8039876-8039898 TGGGAGAAGGGGAGTAGGTTGGG - Intronic
1143707003 17:8705578-8705600 TGGCAGAAGTGTAGTGAGTGAGG - Intergenic
1143958668 17:10696684-10696706 TACGGGAAGGTTAATGAGTTAGG - Intronic
1145101317 17:20080249-20080271 TGGGAGAAAGGGAATGTATTAGG + Intronic
1145291415 17:21549527-21549549 GGGGAGAAGGGAAAAGAGTCAGG + Intronic
1145875860 17:28318033-28318055 TGGGAGGAGGGGACTGAGATAGG - Intergenic
1146022807 17:29293480-29293502 TGGGAAAAGAATAATGAGGTTGG + Intronic
1146559139 17:33853093-33853115 TGGGAGAAGTGTTTTAAGTTGGG - Intronic
1148483485 17:47975701-47975723 CTGGAGAAGGGTCATGAGCTGGG - Intronic
1149015497 17:51904354-51904376 TGGGAGAGGGGTGAGGGGTTTGG - Intronic
1149022769 17:51989295-51989317 TGGGAGAAGGGAAAGGAATCAGG - Intronic
1149356898 17:55848389-55848411 TGGGAGGAGGGTAATTGGTTGGG + Intergenic
1149704936 17:58686419-58686441 TGGGGTGAAGGTAATGAGTTAGG + Intronic
1150444903 17:65221252-65221274 TGGGAGGAGGGCACAGAGTTGGG + Intronic
1151116763 17:71744407-71744429 TGGGAGAAGTGTAATAATTTGGG - Intergenic
1151535683 17:74737595-74737617 TGGCAGAAGAGAACTGAGTTGGG - Intronic
1151706902 17:75773951-75773973 TGGGGGACGGGTCATGAGGTAGG + Intergenic
1152635654 17:81429593-81429615 TGGGGGAAGGGGAGTGAGGTGGG + Intronic
1152943650 17:83186244-83186266 TAAGTGAAGGGTATTGAGTTGGG + Intergenic
1154484812 18:14865219-14865241 TGGGAGAAGGATAAAGAGGGTGG - Intergenic
1155438403 18:25836333-25836355 TTGGAGAAGAGTAAGGAGATGGG + Intergenic
1156447132 18:37245442-37245464 TGGGAGAAGGTTCTTGATTTGGG + Intronic
1158120741 18:54045796-54045818 TTGGGGTAGGGGAATGAGTTAGG - Intergenic
1159750697 18:72297989-72298011 TTGGAAAAGCGTAGTGAGTTTGG + Intergenic
1160350438 18:78174049-78174071 TGAGAGAAGTGCATTGAGTTTGG + Intergenic
1161292088 19:3499981-3500003 TGGGAGCAGCGTGAAGAGTTAGG + Intronic
1162101269 19:8340676-8340698 GTGGAGTAGGGTAATGAGTCAGG - Intronic
1163191044 19:15676841-15676863 TGGGAGGAAGGGAATGAGTGAGG - Intronic
1163191118 19:15677482-15677504 TGGGAGGAGGGGAATGAGTGAGG - Intronic
1165523604 19:36333228-36333250 TGGGGGAAGGGGAAGGAGTGTGG + Intergenic
1165940058 19:39410419-39410441 TGGGAGAGGAGTAATGAGGGAGG - Intergenic
1165995648 19:39841709-39841731 TGGAAGCAGGGAGATGAGTTAGG - Intronic
1166324633 19:42041758-42041780 TGGGAGAAGGGGAGTGTATTTGG - Intronic
1167151162 19:47710704-47710726 TGGGGGAAGGGAGATGATTTAGG + Intergenic
1168303518 19:55420525-55420547 TGTGAGAAGAATAATGAGTTTGG + Intergenic
925296168 2:2779082-2779104 TTGGAGGAAGGTAATGAGTTTGG - Intergenic
927269804 2:21194021-21194043 GGGGAGATAGGTAAGGAGTTTGG + Intergenic
928101505 2:28440085-28440107 TGGGGGAAGCGTCATGAGTCTGG - Intergenic
928133396 2:28669697-28669719 GGGGAGAAGGGTGATGAGCCTGG + Intergenic
929124359 2:38509822-38509844 CAGGAGAAGGGTAATGACCTGGG - Intergenic
930146671 2:48014075-48014097 TGGGGGACAGGTAATGAGGTGGG + Intergenic
930242387 2:48949325-48949347 TGGGAGAGGGGTAAACACTTAGG - Intergenic
930689443 2:54345289-54345311 TGGGACAAGGCAAAGGAGTTTGG + Intronic
930840573 2:55840835-55840857 GGGGAGAAAGATAATGGGTTTGG - Intergenic
931087514 2:58849622-58849644 TGGAAGAAAGCTAATGAGGTAGG - Intergenic
933161678 2:79031020-79031042 TGGGAGAAGGGAAATGATATAGG + Intergenic
933804509 2:85988481-85988503 TGGGAGATGGGTCAGGAGGTGGG - Intergenic
934969161 2:98749142-98749164 TTGGAGAAAGATGATGAGTTTGG - Intergenic
935788700 2:106571398-106571420 TGGGAGAAGGGTTGAAAGTTTGG + Intergenic
937219488 2:120333611-120333633 TGGAAGCAGGGAGATGAGTTAGG - Intergenic
937645735 2:124264342-124264364 TGGGGGAAGGGTATAGATTTGGG - Intronic
937911224 2:127076510-127076532 TTGGAGGAGGGTAATCAGTGTGG - Intronic
938139925 2:128787081-128787103 TGGGGGAATGGGAATGAGGTCGG + Intergenic
939385236 2:141487544-141487566 TGGGATCAGGCTAAGGAGTTTGG - Intronic
939794908 2:146630780-146630802 TAGGGGAAGGGGAAAGAGTTGGG + Intergenic
940148604 2:150574563-150574585 AGGGAGAAGAGTTATGGGTTAGG + Intergenic
940371203 2:152902927-152902949 TTGGAGAAAGGCAAGGAGTTGGG - Intergenic
940883423 2:158968888-158968910 TGGGAGAAGGGAAAGGCGTGTGG + Intronic
941020055 2:160398162-160398184 TGGGGGAAAGGCAGTGAGTTTGG - Intronic
941327794 2:164139404-164139426 TGAAAGGAGGGGAATGAGTTTGG + Intergenic
941372040 2:164677658-164677680 TGTGAGAAGGGTAGAGAGTCAGG - Intronic
943128845 2:183831641-183831663 TGGGAGAATAGGAAAGAGTTGGG - Intergenic
944436230 2:199693079-199693101 TGGTAGAAGTGCAATGTGTTGGG + Intergenic
946300406 2:218820430-218820452 TGGGAGAAGGGTGGTGAGAATGG + Intergenic
947683465 2:232058419-232058441 TGGGTGGAGGGTACTGAGTGGGG + Intronic
947960281 2:234230466-234230488 AGGGAGAAGAGAAATGAGCTTGG + Intergenic
948036977 2:234865656-234865678 TAGGAGAAGAGTAATGTGGTTGG - Intergenic
1169071071 20:2730862-2730884 TGGTAGGAGGGAAATGAGATGGG - Intronic
1169338363 20:4776185-4776207 TGGCAGAAGGGCATGGAGTTTGG - Intergenic
1169366300 20:4995520-4995542 TGGGAGAGGGTAACTGAGTTAGG - Intronic
1169486093 20:6034079-6034101 GGGTAAAAGGGTAATGAGTTAGG - Intronic
1170048733 20:12115527-12115549 TGGCTGAAGGGAAATGAGGTTGG + Intergenic
1170724050 20:18910213-18910235 TGGGAGTAGGGGAACGGGTTTGG + Intergenic
1170945156 20:20884921-20884943 TGTGAGAGCGGTAAAGAGTTGGG - Intergenic
1171125811 20:22601099-22601121 TGAGAGATAGGTAATGAGGTTGG + Intergenic
1173966267 20:47115165-47115187 TGGGAGAAGGGTAAGGTGGTGGG - Intronic
1174386925 20:50192910-50192932 GGGGAGAAGAGTAATGGGTCAGG + Intergenic
1176723562 21:10412573-10412595 TGGGAGAAGGGTAAAGAGAGTGG - Intergenic
1176796515 21:13374256-13374278 TGGGAGAAGGATAAAGAGGGTGG + Intergenic
1177115126 21:17075821-17075843 TTGGAGAAGGGAAATGAGCATGG + Intergenic
1177893586 21:26835442-26835464 TGGGAGAAGTGTAGTTACTTTGG + Intergenic
1178906782 21:36643173-36643195 TTGGAGAAGGGTGATGATCTGGG - Intergenic
1180304719 22:11065345-11065367 TGGGAGAAGGGTAAAGAGGGTGG - Intergenic
1180487782 22:15817884-15817906 TGGAGGAGGGGGAATGAGTTGGG - Intergenic
1181390311 22:22576020-22576042 TGGGAGAAGGGTCAGGGGTCAGG - Intergenic
1181783040 22:25206898-25206920 TGTGAGCAGGGTAAAGAGTTTGG + Intronic
1182332306 22:29559960-29559982 CAGGAGAGGGGGAATGAGTTGGG - Intronic
1184475328 22:44717533-44717555 TGGGGAAAGGGTAATGAGGAGGG - Intronic
1184650580 22:45917796-45917818 TGGGAGGAGGCACATGAGTTGGG + Intergenic
950577714 3:13842739-13842761 TGGGAGAAAGATCAGGAGTTAGG + Intronic
950848287 3:16035807-16035829 TTGGAGAAAGGTAAGAAGTTTGG - Intergenic
951318842 3:21220332-21220354 TGGAAGCAGGGAGATGAGTTAGG - Intergenic
951668076 3:25149145-25149167 TGAGAGAAGGGTGATGAGATTGG + Intergenic
953111977 3:39951334-39951356 TGGGTGAAGGGGAAGGAGATTGG + Intronic
953998322 3:47537123-47537145 TGGGAGAAGAGGAAGGAGGTGGG + Intergenic
956238668 3:67104657-67104679 CAGGAGCAGGATAATGAGTTTGG + Intergenic
957559399 3:81802951-81802973 AAGGAGTAGGGGAATGAGTTGGG - Intergenic
957710464 3:83851225-83851247 TGGGAGAGAAGTGATGAGTTAGG + Intergenic
958069647 3:88593765-88593787 TGGGAGGAGGGTAAAGAACTAGG + Intergenic
961560464 3:127725051-127725073 TGGGAAAAGGGCCATGAGTGTGG - Intronic
962320696 3:134388135-134388157 TGGAAGCAGGGAAATGAGTGAGG - Intergenic
963720164 3:148852877-148852899 TTAGAGAAGGGCAAGGAGTTAGG - Intronic
965697876 3:171428181-171428203 AAGGAGAAGGGAGATGAGTTCGG + Intronic
965781241 3:172288400-172288422 TTGGAGGAGGGTAATGAGACAGG - Intronic
966998440 3:185308507-185308529 TGAGAGAAAGGCCATGAGTTGGG + Intronic
967072067 3:185971076-185971098 TGGGAGCAGGCTGAGGAGTTGGG + Intergenic
967656001 3:192049713-192049735 TCTGAGAAGGGTAGTGAGTGGGG + Intergenic
968348162 3:198029260-198029282 TGAGAGGAGGGAAATTAGTTAGG - Intronic
968424614 4:514185-514207 AAGGAGAAGGGAAATGAGTGTGG - Intronic
969256773 4:6007766-6007788 TGGTGGATGGGTAATGAGGTGGG + Intergenic
969547896 4:7843957-7843979 TGGCAGAGGGGTGATGTGTTTGG - Intronic
971464195 4:26937306-26937328 TGGGAGTAGGGTTGTGAATTAGG + Intronic
972453296 4:39226215-39226237 TAGGAAAAGGGTAAGGAGTAAGG + Intronic
972626175 4:40801258-40801280 TGGGAGAAGGGTATTGTGAATGG + Intronic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973318353 4:48784124-48784146 TGGGACAGGGGAAATGATTTTGG - Intergenic
973637292 4:52871766-52871788 TGGGAGAAGTGTCAGAAGTTTGG - Intergenic
974053806 4:56965642-56965664 TGGAAAAAGGATGATGAGTTCGG + Intronic
974268528 4:59618281-59618303 TGAGGGAAGGGCAATGTGTTAGG + Intergenic
975723211 4:77268095-77268117 TGGGAAAAGGGTAATGAAGGTGG + Intronic
975854494 4:78608758-78608780 TGGGGGGAGGTTTATGAGTTTGG + Intronic
977370116 4:96124702-96124724 TTGCAAAAGGGAAATGAGTTAGG - Intergenic
979615289 4:122735333-122735355 TGGGAGAAGAGTCATAAATTAGG + Intronic
979819671 4:125155126-125155148 TGGGAGCAGGGAAACCAGTTAGG - Intergenic
984143849 4:176036957-176036979 TGGGAGCAGGCTGAAGAGTTGGG + Intergenic
985285694 4:188334521-188334543 TGGGAGAAGGCTAAAAAGGTTGG - Intergenic
987898883 5:23984730-23984752 TGGGAGAGGGGTAAGCAATTTGG - Intronic
988395378 5:30691139-30691161 TGGTAGAAGGGAAATGATGTGGG - Intergenic
988720832 5:33877617-33877639 TGGGAGAAGGGTAGTGAAAACGG + Intronic
989491961 5:42067344-42067366 TCTGAGAAGGGTAGTGAGTGGGG - Intergenic
990441507 5:55850629-55850651 TGGGAGAAATTTAATGAATTTGG + Intergenic
991481439 5:67085339-67085361 TGGAAGCAGGGGGATGAGTTAGG - Intronic
992182694 5:74213537-74213559 AGGGAGAAGGGAGATCAGTTAGG + Intergenic
992379826 5:76226207-76226229 GGGCAGAAGGAAAATGAGTTGGG + Intronic
995167798 5:109067058-109067080 TGGGAGAAGGCTTTTGTGTTTGG + Intronic
995373389 5:111445957-111445979 TGGGGGAAGGGAAATCAGGTAGG + Intronic
996308387 5:122077079-122077101 TGGGCGAAGGGTGAGGAGTAAGG - Intronic
996910300 5:128649744-128649766 TGAGAGAAGGGCTATGAGATGGG - Intronic
998732502 5:145096524-145096546 TGGGAGTAGGGGAAAGAGGTGGG - Intergenic
999237540 5:150108050-150108072 AGTGAGAAGGGTGAGGAGTTGGG + Intronic
999296537 5:150462959-150462981 AGGGAGAAGGGAGATGAGGTGGG + Intergenic
999624667 5:153507487-153507509 TGAGAAAAGAGCAATGAGTTTGG - Intronic
1001722318 5:173866892-173866914 TGGGGCAAGGCTAATGAGTGGGG + Intergenic
1001869845 5:175142463-175142485 TGGGAGAAGGAAAATGACATAGG + Intergenic
1002606420 5:180385425-180385447 TGGGAGAAGGGGAAGGACGTGGG + Intergenic
1002719326 5:181248119-181248141 TGGGAGAGAACTAATGAGTTTGG - Intergenic
1003247351 6:4394538-4394560 TGAGAGAAGGGCAACAAGTTTGG - Intergenic
1003518405 6:6836770-6836792 TGGAAGAGGGGTAATGTTTTGGG + Intergenic
1003853558 6:10250000-10250022 AGGGAGAAGGGCAATGTTTTAGG - Intergenic
1003951522 6:11120429-11120451 TGGCAGAAGGGGAAGGAGTGAGG + Intronic
1006427335 6:33974673-33974695 AGGGAGAAGGCTAATGTGTTTGG - Intergenic
1006598232 6:35209061-35209083 TGGCAGAAGGGAAACAAGTTTGG + Intergenic
1006621410 6:35367202-35367224 TGGGAGAAGGTGAGTGATTTGGG + Intronic
1006800452 6:36756459-36756481 TGGGAGACTGGTATTGAGTCTGG + Intronic
1006919000 6:37615369-37615391 TGGGAGGAGGGAAAGGAGTAAGG - Intergenic
1007025080 6:38563438-38563460 TGGAAGAAGGGAAACCAGTTGGG - Intronic
1009711607 6:67329378-67329400 TGGAAGGAGGGAAATGAGTCAGG + Intergenic
1011828360 6:91338171-91338193 AGGGTCAAGGGTAAAGAGTTCGG - Intergenic
1014964554 6:127730993-127731015 TGTGAGAAGGGGAATGACTATGG - Intronic
1015093877 6:129390932-129390954 TAGGAGAAGGGTTATAAATTAGG - Intronic
1016463563 6:144303638-144303660 TGAGAGAAGGGTCATGCTTTAGG + Intronic
1016562280 6:145410048-145410070 TGGGAGAAGGGTATAGATGTCGG + Intergenic
1016829428 6:148418858-148418880 TGGAAGAAGGGTTATGATTTGGG - Intronic
1018842614 6:167528807-167528829 TTGGAGAAGGTGAAGGAGTTAGG - Intergenic
1019056157 6:169225022-169225044 TGGAAAAAGGGCAATGACTTTGG - Intronic
1021723029 7:23522657-23522679 TGGGAGGAGGGTGAAGAGTATGG - Intronic
1021831934 7:24621669-24621691 TGGGAGAAGGGTAAGCAGCATGG + Intronic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022551302 7:31242024-31242046 GGGGAGAAGAGAAATGAGATAGG + Intergenic
1023373177 7:39531808-39531830 TGCGAGAGGGGTCTTGAGTTCGG + Intergenic
1023924143 7:44652897-44652919 TTGAAGAAGGGTCATCAGTTGGG + Intronic
1024947981 7:54831089-54831111 TGGGAGAAGGTTATTCAGATAGG - Intergenic
1029936063 7:104425172-104425194 TGGGATAATGGGAATGAGATAGG + Intronic
1030324271 7:108203380-108203402 TGGGGGAAGGGTAAAGCTTTAGG + Intronic
1031136141 7:117886251-117886273 AGGGAGAAGGGTAAGGATTGTGG + Intergenic
1031897496 7:127368185-127368207 TAGGAGAAGAGAAATGAATTTGG + Intronic
1032583853 7:133128801-133128823 TGCAACAAGGGTACTGAGTTGGG - Intergenic
1035797812 8:2375669-2375691 TGGAATAAGGGTAATAAGTTGGG + Intergenic
1036182218 8:6595338-6595360 TGGGAGATGGGTCAGGAGTGTGG + Intronic
1037378490 8:18258708-18258730 TGGGAGAAGGATAGTGAGATGGG + Intergenic
1038036729 8:23692418-23692440 TGGGAGAAGGGGGATGTGTGTGG + Intergenic
1038077785 8:24097027-24097049 TGGGAGTAGGGAAGTGAGGTGGG + Intergenic
1039397725 8:37241245-37241267 TGGGGGAAGGTGAATGTGTTAGG + Intergenic
1041584369 8:59498772-59498794 TGGAAGAAAGATTATGAGTTTGG - Intergenic
1042334944 8:67620291-67620313 TGGCAGAAGGGAAATGACATAGG - Intronic
1042454401 8:68983814-68983836 TGGAAGAAGGGGAATGAAGTCGG + Intergenic
1042606125 8:70548459-70548481 TATGAGAAGGGAAGTGAGTTTGG + Intergenic
1043230446 8:77793845-77793867 TGGAAGAAGGGAAAAGAGTGAGG - Intergenic
1044955874 8:97479582-97479604 TGGTATCAGGGTGATGAGTTGGG - Intergenic
1044990763 8:97793809-97793831 TGGGACAAGGGTTAAGAGTTGGG + Intronic
1046353761 8:113050980-113051002 TGGGAGAAGGGAAGTGAGAAAGG + Intronic
1046682132 8:117182177-117182199 GGGGTGAAGGGTCAGGAGTTGGG + Intergenic
1049282614 8:141758092-141758114 TAGAAAAAGGGTAATGAGATGGG - Intergenic
1049762845 8:144338696-144338718 TGGGGGAAGGGGACAGAGTTGGG - Intergenic
1050626467 9:7509257-7509279 GTGGAGAAGGGTAAAAAGTTAGG + Intergenic
1052482770 9:29052707-29052729 TTGGAGAAGGGTGAAGACTTTGG + Intergenic
1053216202 9:36272683-36272705 TGGAAGAAGGGAAACCAGTTAGG + Intronic
1054731035 9:68703420-68703442 TGGGAAAAGGGTCATGTGTATGG + Intergenic
1056795280 9:89654935-89654957 TGGAAGAAGGGTAATGTGGCAGG - Intergenic
1057454949 9:95199507-95199529 TGGGAGAAGGGTGGCTAGTTAGG - Intronic
1057923153 9:99116266-99116288 TGGGAGAAGGGAAAGGAGGGAGG + Intronic
1058047994 9:100377839-100377861 TGTGAGAATGGTAAGGATTTAGG + Intergenic
1058117466 9:101100490-101100512 TGAGAGAAGTGTGAGGAGTTGGG - Intronic
1059550302 9:115222354-115222376 AGGGAGAATGGTACTGAGTTGGG + Intronic
1062703578 9:137921326-137921348 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703586 9:137921383-137921405 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703593 9:137921440-137921462 TGGGAGCAGAGTAAAGTGTTCGG + Intronic
1062703598 9:137921497-137921519 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703605 9:137921554-137921576 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703611 9:137921611-137921633 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703618 9:137921668-137921690 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703624 9:137921725-137921747 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703629 9:137921782-137921804 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703635 9:137921839-137921861 TGGGAGCAGAGTAAAGTGTTTGG + Intronic
1062703640 9:137921896-137921918 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703647 9:137921953-137921975 TGGGAGCAGAGTAAAGTGTTCGG + Intronic
1062703659 9:137922067-137922089 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703670 9:137922180-137922202 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703676 9:137922237-137922259 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703687 9:137922351-137922373 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1062703693 9:137922407-137922429 TGGGAGCAGAGTAAAGCGTTCGG + Intronic
1186221466 X:7354000-7354022 TGGGAGAAGGTTGAGGAGCTTGG - Exonic
1186988207 X:15039126-15039148 TGAGAGAAGGGTAATTTATTTGG - Intergenic
1187565239 X:20443225-20443247 TGGGAGAGTGGTACTGATTTGGG - Intergenic
1188047563 X:25444878-25444900 CCAGAGAAGGGTAAAGAGTTGGG - Intergenic
1188607239 X:32046326-32046348 GAGGAGAAGGGTAATGAATGTGG - Intronic
1190387090 X:49892914-49892936 GGGGAGTAGGGAGATGAGTTAGG + Intergenic
1190712757 X:53081790-53081812 TGGGAGAAGGGGCAGGAGCTGGG + Intergenic
1191857157 X:65636349-65636371 TGGGAGAGTGGTAGAGAGTTTGG - Intronic
1192493442 X:71596718-71596740 TGGGAGGAAGGTGATGAGTTTGG + Intronic
1193272598 X:79546306-79546328 TTGGAGCAGGGTAATGGGTAGGG - Intergenic
1193677981 X:84480846-84480868 TAGTACTAGGGTAATGAGTTAGG + Intronic
1194971581 X:100349856-100349878 TGGGAGAAGGACAAGGGGTTTGG - Intronic
1196462391 X:115944090-115944112 GGGGAGAGGGGAAATGGGTTGGG - Intergenic
1197896940 X:131326391-131326413 TGGGAGAGGGGTATTTTGTTCGG + Intronic
1198657990 X:138935503-138935525 TGGAAGAAGGGTAATAAGTGGGG - Intronic
1199447601 X:147944129-147944151 TGGGAGAGGGGTTAGGGGTTAGG - Intronic
1199862913 X:151818077-151818099 GGGGAAAAGGGTGATGGGTTTGG - Intergenic
1202385814 Y:24325500-24325522 TGGGAGAAAGGTAAAGAGATGGG - Intergenic
1202484972 Y:25344628-25344650 TGGGAGAAAGGTAAAGAGATGGG + Intergenic