ID: 924874812

View in Genome Browser
Species Human (GRCh38)
Location 1:248090553-248090575
Sequence TAGCCTAAGCAAACCAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 523}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924874812_924874816 10 Left 924874812 1:248090553-248090575 CCTTGGTTGGTTTGCTTAGGCTA 0: 1
1: 0
2: 0
3: 27
4: 523
Right 924874816 1:248090586-248090608 CTTCATCCATGTTGCTGCAAAGG 0: 88
1: 1733
2: 9495
3: 17256
4: 18688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924874812 Original CRISPR TAGCCTAAGCAAACCAACCA AGG (reversed) Intronic
902076269 1:13789163-13789185 GAGCCAAAGCAACCCAAACAGGG - Intronic
902793655 1:18786073-18786095 TACCCCAAGCAAACCCACAATGG + Intergenic
903919403 1:26788498-26788520 TACCCTAAGCATACCTAGCAAGG + Exonic
904933623 1:34110597-34110619 TATCCTTAGCAAACCAACACAGG + Intronic
904986874 1:34558337-34558359 TATCCTAAGCAAACTAACATAGG - Intergenic
906906794 1:49903219-49903241 TATCCTAAGCAAACTAACACAGG + Intronic
907062889 1:51449314-51449336 TATCCTAAGCAAACTAACACAGG + Intronic
907311527 1:53541656-53541678 AAACCAAAGGAAACCAACCAGGG + Intronic
908592541 1:65649310-65649332 TATCCTTAGCAAACTAACAAGGG - Intergenic
908710587 1:67010060-67010082 TATCCTAAGCAAACTAACACAGG + Intronic
908912112 1:69083938-69083960 TATCCTTAGCAAACCAACACAGG - Intergenic
910203888 1:84727874-84727896 TATCCTAAGCAAACTAACACAGG - Intergenic
910605998 1:89085489-89085511 TATCCTAAGCAAACTAACACAGG + Intergenic
910731647 1:90404083-90404105 TATCCTAGGCAAACCAACAAAGG - Intergenic
910820124 1:91336956-91336978 TATCCTCAGCAAACCAACACAGG + Intronic
911245120 1:95508451-95508473 GATCCTAAGCAAACCAACGCAGG - Intergenic
911514136 1:98846365-98846387 TATCCTAAGCAAACTAACACAGG - Intergenic
911657518 1:100461635-100461657 TAGCCTTAGCTAATCAGCCAAGG - Intronic
912972465 1:114296779-114296801 TAAACTAAGCAAACAAAACATGG + Intergenic
913427816 1:118754013-118754035 TATCCTAAGCAAACTAACACAGG - Intergenic
913442838 1:118917294-118917316 TATCCTAAGCAAACGAACGCAGG + Intronic
916318376 1:163475727-163475749 TATCCTAAGCAAACTAACATAGG - Intergenic
916390718 1:164328105-164328127 TATCCTAAGCAAACTAACACTGG + Intergenic
916956274 1:169839046-169839068 TACCCTAAGCAAATTAACAAAGG - Intronic
917261718 1:173176847-173176869 TATCCTAAGCAAACTAATCCAGG + Intergenic
918024432 1:180729106-180729128 TATCCTAAGCAAACTAACACAGG - Intronic
918133567 1:181649728-181649750 TATCCTCAGCAAACCAACACAGG + Intronic
918165086 1:181937270-181937292 TATCCTAAGCAAACCAACACAGG - Intergenic
918558636 1:185836895-185836917 TAGCCTAAGCAAACTAACACAGG - Intronic
918855446 1:189749538-189749560 TATCCTTAGCAAACTAACCCAGG - Intergenic
920585034 1:207150461-207150483 TATCCTCAGCAAACCAACACAGG - Intergenic
920890460 1:209979719-209979741 TATCCTCAGCAAACAAACCCAGG - Intronic
922395416 1:225195380-225195402 TATCCTAAGCAAACTAACTCAGG + Intronic
923739773 1:236644708-236644730 TATCCTTAGCAAACCAACACAGG - Intergenic
924388861 1:243528589-243528611 AAGCCTAAGCAAACTAACACAGG - Intronic
924392497 1:243578409-243578431 TATCCTAAGCAAACTAACGCAGG + Intronic
924463229 1:244277809-244277831 TAGCCTAAGCAAACTAACACAGG - Intergenic
924840358 1:247703960-247703982 TATCCTTAGCAAACTAACCCAGG - Intergenic
924874812 1:248090553-248090575 TAGCCTAAGCAAACCAACCAAGG - Intronic
924891094 1:248280870-248280892 TAGTCTAAGCAAAGCAACAAAGG - Intergenic
1063448015 10:6132338-6132360 TATCCTAAGCGAACCAACACAGG + Intergenic
1063616712 10:7606478-7606500 TATCCTAAGCAAATTAACCCAGG + Intronic
1063625377 10:7684837-7684859 TATCCTAAGCAAACTAACACAGG + Intergenic
1063671952 10:8106068-8106090 TATCCTAAGCAAACTAACACAGG - Intergenic
1063812521 10:9728835-9728857 TATCCTAAGCAAACTAACACAGG + Intergenic
1064798584 10:19042149-19042171 TAACCTCAGCAAACTAACCCGGG - Intergenic
1064892032 10:20186680-20186702 TATCCTTAGCAAACTAACCGAGG - Intronic
1066036247 10:31489438-31489460 TGGCCTAAACAAACCAATTAAGG - Intronic
1066569647 10:36756886-36756908 TAGTCTAAGCAAAACAACAGAGG + Intergenic
1068185369 10:53578415-53578437 TATCCTCAGCAAACTAACAAAGG + Intergenic
1069341155 10:67410231-67410253 TATCCTTAGCAAACCAACACAGG + Intronic
1069942947 10:71967440-71967462 TATCCTAAGCAAACTAACACAGG - Intronic
1072115143 10:92363756-92363778 TATCCTAAGCAAACTAACATAGG + Intergenic
1072871869 10:99128557-99128579 TATCCTCAGCAAACTAACAAAGG + Intronic
1073626423 10:105102404-105102426 TATCCTAAGCAAACTAACACTGG + Intronic
1073832315 10:107399266-107399288 TATCCTAAGCAAACTAACACAGG - Intergenic
1074013679 10:109510294-109510316 TATCCTAAGCAAACTAACATAGG - Intergenic
1075482288 10:122792243-122792265 AAGCCTAGTGAAACCAACCATGG + Intergenic
1076610113 10:131720241-131720263 TAGCCTCAGCAAACTAACACAGG - Intergenic
1078078362 11:8182282-8182304 TATCCTAAGCAAACTAACACAGG - Intergenic
1079300379 11:19273709-19273731 TATCCTAAGCAAACTAACACAGG + Intergenic
1079879983 11:25914986-25915008 TAGCCTAAGCAAACTAATGCAGG + Intergenic
1079977770 11:27113529-27113551 TATCCTAAGCAAACTAACACAGG + Intronic
1080083450 11:28249989-28250011 TATCCTAAGCAAACTAACTCAGG - Intronic
1080112404 11:28582734-28582756 TAGCATAATCAGAGCAACCATGG - Intergenic
1080398650 11:31913644-31913666 TATCCTTAGCAAACTAACAAAGG - Intronic
1081223007 11:40485869-40485891 TATCCTAAGCAAACTAACACAGG + Intronic
1082673807 11:56070474-56070496 TATCCTAAGCAAACTAACACAGG - Intergenic
1083134422 11:60658321-60658343 TGGCCTCAGAGAACCAACCATGG + Intergenic
1083536431 11:63471916-63471938 TATCCTAAGCAAACTAACACAGG + Intronic
1085064173 11:73477090-73477112 TATCCTAAGCAAATTAACCCAGG + Intronic
1085755743 11:79199962-79199984 TGGCCTCACCATACCAACCAAGG + Intronic
1086526423 11:87732354-87732376 TATCCTAAGCAAACTAATCCAGG - Intergenic
1087553808 11:99688872-99688894 TATCCTTAGCAAACTAACCCAGG - Intronic
1087935181 11:104025649-104025671 TGGCCTAAGCAAATCTCCCAAGG + Intronic
1088156400 11:106809386-106809408 TCACCAAATCAAACCAACCATGG + Intronic
1088338850 11:108740249-108740271 TATCCTAAGCAAACTAACAAAGG - Intronic
1088409284 11:109515425-109515447 TATCCTAAGCAAACTAACACAGG - Intergenic
1089996587 11:122913615-122913637 TTTCCTAAGCAAACAAGCCAGGG - Intronic
1090684983 11:129106397-129106419 TAGCCTAAGCAAATTAACACAGG + Intronic
1091159102 11:133403444-133403466 TAAACTAAGCAAACAAATCAAGG - Intronic
1093019625 12:14191340-14191362 TATCCTAAGCAAACTAACACAGG + Intergenic
1093481655 12:19610199-19610221 TATCCTAAGCAAACTAACACAGG - Intronic
1093587044 12:20850772-20850794 TATCCTAAGCAAACTAACACAGG - Intronic
1094079583 12:26518244-26518266 TATCCTAAGCAAACTAACACAGG + Intronic
1094386525 12:29900356-29900378 TATCCTAAGCAAACTAACCCAGG - Intergenic
1094723265 12:33086899-33086921 TATCCTTAGCAAACCAACACAGG - Intergenic
1095346559 12:41156825-41156847 TATCCTCAGCAAACTAACAAAGG - Intergenic
1095690617 12:45084376-45084398 TAGCCTCAGCAAACTAACACAGG - Intergenic
1095853560 12:46836361-46836383 TAGCCTTAGCAAACCAATGCAGG - Intergenic
1096338108 12:50773034-50773056 TATCCTCAGCAAACTAACAAAGG - Intronic
1096884723 12:54705574-54705596 TATCCTAAGCAAACAAACACAGG - Intergenic
1097413838 12:59289392-59289414 TATCCTAAGCAAACTAACACAGG - Intergenic
1097542891 12:60962488-60962510 TATCCTTAGCAAACTAACCCAGG + Intergenic
1098272832 12:68785394-68785416 TAGGCAAAGCAATCTAACCAAGG + Intronic
1098347341 12:69519673-69519695 TATCCTAAGCAAACTAACACAGG - Intronic
1098384976 12:69909029-69909051 TATCCTTAGCAAACCAACACAGG - Intronic
1098459007 12:70711266-70711288 TAGCCTTAGCAAACTAACACAGG + Intronic
1098816531 12:75172200-75172222 TATCCTCAGCAAACCAACGCAGG + Intronic
1099603252 12:84768415-84768437 TATCCTTAGCAAACTAACCCAGG - Intergenic
1099634156 12:85192272-85192294 TATCCTAAGCAAACTAACACAGG - Intronic
1099753397 12:86807391-86807413 TATCCTCAGCAAACCAACGTAGG - Intronic
1099946361 12:89249281-89249303 TATCCTAAGCAAACTAACACAGG + Intergenic
1100165170 12:91908907-91908929 TACCCTCAGCAAACTAACAAAGG + Intergenic
1100293741 12:93241249-93241271 TATCCTCAGCAAACAAACAATGG + Intergenic
1100660970 12:96698553-96698575 TATCCTAAGCAGACTAACCCAGG + Intronic
1102648393 12:114418723-114418745 TATCCTTAGCAAACTAACGAAGG + Intergenic
1102835333 12:116052689-116052711 TAGCCTAAGCAAAGCAAGATTGG - Intronic
1103047628 12:117750773-117750795 TATCCTAAGCAAACTAACACAGG - Intronic
1104137872 12:125957720-125957742 TATCCTCAGCAAACCAACACGGG - Intergenic
1104296459 12:127519164-127519186 TATCTTCAGCAAACCAACCCAGG - Intergenic
1104543770 12:129692723-129692745 TATCCTTAGCAAACTAACAAAGG + Intronic
1104612414 12:130240589-130240611 TATCCTAAGCAAACTAACACAGG + Intergenic
1105245247 13:18644325-18644347 TTGCCTAGGCAAACCAACATCGG - Intergenic
1107189098 13:37558557-37558579 TATCCTTAGCAAACTAACAAAGG + Intergenic
1107208950 13:37828708-37828730 TATCCTAAGCAAACTAACACAGG + Intronic
1107997858 13:45878445-45878467 TAGCCCTAGCAAACCAACACAGG + Intergenic
1108129565 13:47283149-47283171 TATCCTAAGCAAACTAACACGGG - Intergenic
1108756683 13:53511444-53511466 TATCCTAAGCAAACTAACACAGG - Intergenic
1108776116 13:53767302-53767324 TATCCTTAGCAAACTAACAAAGG + Intergenic
1108978114 13:56475258-56475280 TATCCTAAGCAAACTAACACAGG + Intergenic
1109374839 13:61478727-61478749 TATCCTTAGCAAACCAACGCAGG - Intergenic
1109485588 13:63015058-63015080 TATCCTTAGCAAACTAACCCAGG - Intergenic
1110069342 13:71153767-71153789 TATCCTTAGCAAACTAACAAAGG - Intergenic
1110260854 13:73483728-73483750 TATCCTCAGCAAACTAACCCGGG + Intergenic
1110670928 13:78176600-78176622 TATCCTTAGCAAACTAACAAAGG - Intergenic
1110829734 13:80017393-80017415 TAGCCTCAGCAAACTAACACAGG + Intergenic
1111179392 13:84642095-84642117 TAACCTAAGCAAATCAACACAGG + Intergenic
1111313666 13:86522620-86522642 TAGCCTTAGCAAACTAACACAGG + Intergenic
1111369018 13:87291546-87291568 TACCCTAAGCAAATCAACACAGG - Intergenic
1111676092 13:91390695-91390717 TATCCTCAGCAAACTAACAAAGG + Intergenic
1112648600 13:101365312-101365334 TATCCTAAGCAAACTAACACAGG - Intronic
1112913316 13:104516686-104516708 TATCCTAAGCAAACTAACGTAGG - Intergenic
1113202381 13:107881053-107881075 TATCCTAAGCAAATCAACACAGG + Intergenic
1113281224 13:108790015-108790037 TACCCTAGGGAAACCAACCGTGG + Intronic
1113307294 13:109092456-109092478 TATCCTTAGCAAACCAACAGAGG + Intronic
1114160073 14:20155526-20155548 TATCCTAAGCAAACTAACACAGG - Intergenic
1114330353 14:21630676-21630698 TATCCTTAGCAAACTAACCCAGG + Intergenic
1115013422 14:28578888-28578910 TATCCTAAGCAAACTAACACAGG - Intergenic
1115332620 14:32214246-32214268 TAGTCTAAGGAAACCATCAAAGG - Intergenic
1115852805 14:37600538-37600560 TAGCCAAAGCTAAACCACCAGGG - Intronic
1115915397 14:38307006-38307028 TATCCTAAGCAAACTAACACAGG + Intergenic
1115944209 14:38641866-38641888 TATCCTTAGCAAACCAACACAGG + Intergenic
1116261191 14:42629544-42629566 TATCCTTAGCAAACTAACAAGGG - Intergenic
1116809972 14:49530027-49530049 TATCCTTAGCAAACTAACCCAGG + Intergenic
1117259877 14:54021059-54021081 TATCCTAAGCGAACTAACAAAGG + Intergenic
1117664317 14:58040429-58040451 TATCCTAAGCAAACTAACACAGG - Intronic
1118435622 14:65768314-65768336 TATCCTAAGCAAACTAACACAGG - Intergenic
1118605864 14:67502941-67502963 TATGGTAAGCAAAACAACCATGG + Intronic
1118948414 14:70410740-70410762 TATCCTTAGCAAACTAACAAAGG + Intronic
1119987031 14:79149732-79149754 TATCCTCAGCAAACCAACGCAGG + Intronic
1120147526 14:80995553-80995575 TATCCTCAGCAAACCAACACAGG + Intronic
1120820292 14:88905912-88905934 TATCCTAAGCAAACAAACACAGG - Intergenic
1121572031 14:94953461-94953483 TATCCTTAGCAAACTAACAAAGG - Intergenic
1121955198 14:98207103-98207125 TAGCCTCAGCAGGCCAACCAGGG - Intergenic
1124908652 15:33896573-33896595 TGGTCTAAGCACACCCACCACGG + Intronic
1125291846 15:38157796-38157818 TATCCTAAGCAAACTAACACAGG + Intergenic
1126160228 15:45605418-45605440 TAGCCTCAGCAAACTTAACATGG - Exonic
1126196771 15:45940055-45940077 TATCCTTAGCAAACCAACACAGG + Intergenic
1127320662 15:57841979-57842001 TATCCTAAGCAAACTAACACTGG - Intergenic
1127462523 15:59212326-59212348 TAGCTACAGCAAAACAACCAAGG + Intronic
1128630279 15:69258262-69258284 TATCCTTAGCAAACCAACGCAGG - Intronic
1130825411 15:87540164-87540186 TATCCTAAGCAAAGTAACCCTGG + Intergenic
1131047447 15:89325377-89325399 TAGCCTGAGCTGACCAGCCAGGG + Intronic
1131520171 15:93108554-93108576 TATCCTAAGCAAACTAACACAGG + Intergenic
1131905874 15:97142001-97142023 TATTTTAAGCTAACCAACCAAGG + Intergenic
1131984449 15:98027763-98027785 TACCCTAAGCAAACTAACACAGG + Intergenic
1133528739 16:6632617-6632639 TAGCTCAAGCAAAACACCCATGG - Intronic
1135968441 16:27054607-27054629 TATCCTAAGCAAACTAACACAGG - Intergenic
1136075344 16:27813338-27813360 TATCCTTAGCAAACCAACGCAGG - Intronic
1136162763 16:28431457-28431479 TATCCTAAGCAAATTAACCCAGG - Intergenic
1136200203 16:28683531-28683553 TATCCTAAGCAAATTAACCCAGG + Intergenic
1136216551 16:28797724-28797746 TATCCTAAGCAAATTAACCCAGG + Intergenic
1137064344 16:35823995-35824017 TATCCTCAGCAAACCAACACAGG - Intergenic
1137438252 16:48476061-48476083 TAGCCTTAGCAAACTAACACAGG + Intergenic
1137916291 16:52434042-52434064 AAGCCAAAGCAAATCAATCAAGG - Intergenic
1138082245 16:54101388-54101410 TATCCTTAGCAAACTAACCCTGG - Intronic
1139456491 16:67082869-67082891 TATCCTAAGTAAACCAGCAAAGG - Intronic
1139463378 16:67140726-67140748 GAGCCTATGCAAAACAACCCTGG - Intronic
1140266138 16:73422826-73422848 AAGCCCAAGCAAACTAACCCAGG - Intergenic
1140286431 16:73606847-73606869 TATCCTCAGCAAACTAACCCAGG - Intergenic
1140337014 16:74117340-74117362 TATCCTCAGCAAACTAACAAAGG + Intergenic
1141274655 16:82576324-82576346 TTGCCTTAGCAAACCATACATGG + Intergenic
1141377746 16:83547567-83547589 TATCCTTAGCAAACTAACCCAGG - Intronic
1141881737 16:86864694-86864716 TATCCTAAGCAAACAAACACAGG - Intergenic
1141937368 16:87249989-87250011 TATCCTAAGCAAACTAACACAGG + Intronic
1142317855 16:89360172-89360194 TAGCCTCAGCAAACTAACTCAGG - Intronic
1144414061 17:15029558-15029580 AGGGCTAAGGAAACCAACCAAGG - Intergenic
1144652579 17:17016786-17016808 TAGCCAAGGCAAAGCAAGCAAGG - Intergenic
1146913440 17:36662960-36662982 TGGCCTGAGTAAACCAACCAAGG + Intergenic
1147007332 17:37414064-37414086 TATCCTAAGCAAACTAACACAGG - Intronic
1147523224 17:41194984-41195006 TATCCTAAGCAAACTAACACCGG + Intronic
1150189859 17:63226867-63226889 TATCCTAAGCAAACTAACACAGG - Intronic
1150939901 17:69681373-69681395 TATCCTAAGCAAACTAACACAGG - Intergenic
1151060730 17:71090688-71090710 TATCCTAAGCAAACTAACATAGG - Intergenic
1152656727 17:81523343-81523365 TGGCCTCAGTAAACCAACCCAGG + Intronic
1153068716 18:1079449-1079471 TATCCTAAGCAAAGTAACAAAGG + Intergenic
1153153822 18:2126723-2126745 TATCCTAAGCAAACTAACACAGG - Intergenic
1153272902 18:3340980-3341002 TATCCTAAGCAAACTAACACAGG + Intergenic
1153915031 18:9737808-9737830 TAGCATAAGGAAACCAAGCAGGG + Intronic
1154443701 18:14415607-14415629 TTGCCTAGGCAAACCAACATCGG + Intergenic
1156067883 18:33167044-33167066 TATCCTAAGCAAACTAACACAGG - Intronic
1156078104 18:33305057-33305079 TAGCTTAATGAAACCAAACAAGG + Intronic
1156171169 18:34487797-34487819 TGGCAAAAGCAAACCAAACAAGG + Intergenic
1156342968 18:36228556-36228578 TAGCCTTAGCAAACCAACATAGG + Intronic
1156370597 18:36468567-36468589 CAGCCTGAGCAAATCAATCAGGG + Intronic
1156402186 18:36749444-36749466 TATCCTTAGCAAACCAACACGGG - Intronic
1157111817 18:44827610-44827632 TAGCCTTATCAATCAAACCATGG + Intronic
1157373882 18:47144881-47144903 TAACCTAAGGAAACAAGCCATGG + Intronic
1157826087 18:50813707-50813729 TATCCTAAGCAAACTAACACAGG + Intronic
1159410646 18:68071376-68071398 TATCCTAAGCAAACTAACACGGG + Intergenic
1162197255 19:8994663-8994685 TATCCTTAGCAAACTAACCCAGG - Intergenic
1163181050 19:15602287-15602309 TATCCTAAGCAAACTAACACAGG - Intergenic
1163492509 19:17625076-17625098 TAGCCCCATCAAACCACCCAGGG - Intronic
1164448349 19:28336936-28336958 TATCCTAAGCAAACTAACACAGG + Intergenic
1168443166 19:56389401-56389423 TATCCTAAGCAAACTAACACAGG + Intronic
926836050 2:17022310-17022332 TATCCTAAGCAAACTAACACAGG - Intergenic
927038038 2:19201569-19201591 CAGCCTAAGCTAATCCACCATGG - Intergenic
927840088 2:26435681-26435703 TATCCTAAGCAAACTAACATAGG - Intronic
928346899 2:30507577-30507599 TATCCTAAGCAAACTAACGCAGG - Intronic
928755106 2:34515223-34515245 TATCCTTAGCAAACTAACAAAGG + Intergenic
928886129 2:36150551-36150573 TATCCTAAGCAAACTAACACAGG + Intergenic
929718265 2:44336411-44336433 TATCCTAAGCAAGCCAACAGAGG + Intronic
930335004 2:50034368-50034390 TATCCTTAGCAAACCAACACAGG + Intronic
930461987 2:51693049-51693071 TATCCTAAGCAAACTAACACAGG + Intergenic
930836409 2:55798624-55798646 TATCCTAAGCAAATCGACCAAGG + Intergenic
930865239 2:56116237-56116259 TATCCTTAGCAAACTAACAAAGG - Intergenic
931398039 2:61905588-61905610 TAGCCTGTGCAAAACCACCACGG - Intronic
933114939 2:78456684-78456706 TATCCTTAGCAAACCAACACAGG - Intergenic
933404159 2:81836841-81836863 TATCCTCAGCAAACTAACCCAGG - Intergenic
933440470 2:82307053-82307075 TAGCCAAAACAAACAAACAAAGG - Intergenic
933534971 2:83560163-83560185 TAGCCTATGAAAGCCAATCAGGG + Intergenic
934041734 2:88132643-88132665 TATCCTAAGCAAACGAACACAGG + Intergenic
935138033 2:100324633-100324655 TATCCTCAGCAAACCAACACAGG + Intergenic
935449789 2:103196115-103196137 TACCCTAAGCAAACTAACACAGG + Intergenic
937232974 2:120410970-120410992 TATCCTCAGCAAACTAACCCAGG - Intergenic
937552891 2:123116375-123116397 TAGCCTAAGCGAACTAACACAGG - Intergenic
938285904 2:130116618-130116640 TATCCTTAGCAAACTAACAAAGG - Intronic
938429701 2:131222284-131222306 TATCCTTAGCAAACTAACAAAGG + Intronic
938785428 2:134624339-134624361 TATCCTTAGCAAACTAACAAAGG + Intronic
938861356 2:135372850-135372872 TAGCCTAAGCAATCCTGCCTTGG - Intronic
938866684 2:135429260-135429282 TATCCTAAGCAAATTAACAAAGG + Intronic
939195481 2:138965761-138965783 TAAACTAAGCAAACTAACCCAGG - Intergenic
939987277 2:148842387-148842409 TATCCTAAGCAAATTAACCCAGG - Intergenic
940392854 2:153152673-153152695 TATCCTTAGCAAACTAACAAAGG - Intergenic
940527058 2:154829395-154829417 TATCCTAAGCAAACTAACGCAGG - Intronic
940773832 2:157866417-157866439 AATCCTAAGCAAACAAGCCAAGG + Intronic
940779067 2:157914237-157914259 TATCCTAAGCAAATTAACCCAGG + Intronic
941436694 2:165481805-165481827 TATCCTAAGCAAACTAACACAGG + Intronic
942050795 2:172138975-172138997 TATCCTTAGCAAACCAACTAAGG + Intergenic
942201281 2:173573890-173573912 TATCCTAAGCAAACTAACACAGG - Intergenic
942829195 2:180218962-180218984 TACCCTAAGCAAGCTAACAAAGG + Intergenic
944172638 2:196796783-196796805 TATCCTCAGCAAACCAACACAGG - Intronic
944337313 2:198550898-198550920 TAGCAAAAGCAAACCAGGCAGGG + Intronic
945158131 2:206860483-206860505 TATCCTCAGCAAACTAACAAAGG - Intergenic
945177390 2:207056452-207056474 TATCCTTAGCAAACTAACTAAGG + Intergenic
945290982 2:208127231-208127253 TATCCTAAGCAAACTAACACAGG - Intergenic
945441428 2:209884773-209884795 TATCCTCAGCAAACTAACGAAGG + Intronic
945851167 2:215009200-215009222 TATCCTTAGCAAACCAACACAGG + Intronic
947280950 2:228454097-228454119 TATCCTAAGCAAATTAACAAAGG - Intergenic
947391460 2:229643568-229643590 TAGCCTAAGTAACCTACCCAAGG - Intronic
948077859 2:235180312-235180334 TATCCTAAGCAAACGAACGCAGG - Intergenic
1169406338 20:5324358-5324380 TATCCTAAGCAAACTAACACAGG - Intergenic
1169524574 20:6409639-6409661 TATCCTAAGCAAACCAATTAAGG + Intergenic
1170190881 20:13643810-13643832 TATCCTAAGCAAACTAACGCAGG - Intergenic
1171308573 20:24127188-24127210 TATTCTAAGCAAATTAACCAGGG + Intergenic
1171333785 20:24364595-24364617 GAGACTTAGCAAACCAACAAGGG + Intergenic
1172567247 20:35940294-35940316 GGGCCTCAGCAAAGCAACCAGGG + Intronic
1172902082 20:38342746-38342768 AAGCTTGAGGAAACCAACCAGGG + Intergenic
1175783487 20:61698008-61698030 GAGCCTGAGCAAAACAGCCAAGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176452385 21:6875616-6875638 TTGCCTAGGCAAACCAACATCGG - Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1176830558 21:13740665-13740687 TTGCCTAGGCAAACCAACATCGG - Intergenic
1177272215 21:18864229-18864251 TATCCTTAGCAAACCAACACAGG - Intergenic
1177286412 21:19057161-19057183 TATCCTTAGCAAACTAACAAAGG - Intergenic
1177370925 21:20202203-20202225 TAACCTAAGCAAACTAACCCAGG - Intergenic
1178489534 21:33040347-33040369 TATCCTAAGCAAACTAACACAGG - Intergenic
1178814984 21:35921093-35921115 TATCCTTAGCAAACTAACCCAGG + Intronic
1178924176 21:36761439-36761461 AAGTCTAAGTAAACCAAGCATGG + Intronic
1179023789 21:37662368-37662390 TATCCTTAGCAAACCAACACAGG - Intronic
1184048514 22:41987501-41987523 TATCCTAGGCCCACCAACCAGGG + Intronic
949218869 3:1605487-1605509 TATCCTAAGCAAATTAACAAAGG - Intergenic
949343930 3:3059126-3059148 GTGCCACAGCAAACCAACCAGGG + Intergenic
951432379 3:22623016-22623038 TAGCCTCAGCAAACTAACATAGG - Intergenic
952278120 3:31897169-31897191 TAGCCTCAGCAAACCAGCGGAGG + Intronic
953122760 3:40061349-40061371 TAGCCTTAGCAAACTAACAAAGG - Intronic
953249181 3:41227988-41228010 TATCCTAAGCAAACTAACATAGG - Intronic
954853409 3:53622497-53622519 TATCCTTAGCAAACTAACCCAGG + Intronic
955425403 3:58784193-58784215 TATCCTAAGCAAATTAACCCAGG - Intronic
955502905 3:59602533-59602555 TATCCTTAGCAAACTAACAAGGG - Intergenic
955563143 3:60214892-60214914 TATCCTAAGCAAACTAACACAGG + Intronic
955807781 3:62755244-62755266 TAGCACCAGCAGACCAACCAGGG - Intronic
956009192 3:64812541-64812563 TATCCTTAGCAAACTAACCCAGG - Intergenic
957131932 3:76234087-76234109 TATCCTAAGCAAACTAACACAGG - Intronic
957175221 3:76799371-76799393 TAGCTAAAGCAATCCAACAAGGG + Intronic
958515402 3:95108935-95108957 AATCCTAAGCAAAACAACAAAGG - Intergenic
958774798 3:98469158-98469180 TATCCTAAGCAAACTAATGAAGG + Intergenic
958842921 3:99230390-99230412 TATCCTAAGCAAACTAACACAGG - Intergenic
959284015 3:104383938-104383960 TATCCTAAGCAAACTAACACAGG + Intergenic
960215189 3:115025210-115025232 TAGCCTTAGCGAACTAACAAAGG - Intronic
960422351 3:117462748-117462770 TATCCTAAGCAAACTAACACAGG - Intergenic
960532175 3:118777553-118777575 TATCCTAAGCAAACTAACACAGG + Intergenic
960678087 3:120216768-120216790 TATCCTTAGCAAACCAACACAGG - Intronic
961417210 3:126767862-126767884 TATCCTAAGCAAACTAACACAGG - Intronic
962079072 3:132117767-132117789 CAGCCTCAGCTAACCTACCAGGG - Intronic
962124054 3:132596156-132596178 TATCCTTAGCAAACTAACAAAGG + Intronic
962441494 3:135422531-135422553 TATCCTCAGCAAACTAACAATGG - Intergenic
962682911 3:137818672-137818694 TATCCTAAGCAAACTAACACAGG + Intergenic
965087875 3:164122917-164122939 TATCCTAAGAAAACTAACAAAGG + Intergenic
965182364 3:165420672-165420694 TATCCTTAGCAAACTAACCCAGG + Intergenic
966263509 3:178009067-178009089 TATCCTTAGCAAACTAACCCAGG + Intergenic
966743650 3:183254985-183255007 TAACCTAAGAAAACCAACACCGG - Intronic
967619088 3:191610147-191610169 TATCCTAAGCAAACTAACACAGG - Intergenic
969160155 4:5250022-5250044 TCCCCTAAGCAAACTAACCCAGG - Intronic
969780359 4:9396995-9397017 TATCCTCAGCAAACTAACCCAGG + Intergenic
970736953 4:19182649-19182671 TATCCTCAGCAAACTAACCCAGG + Intergenic
970772005 4:19625027-19625049 TATCCTCAGCAAACTAACGAAGG - Intergenic
972318742 4:37952504-37952526 TATCCTCAGCAAACTAACAAAGG + Intronic
972893721 4:43592723-43592745 AATCCTAAGCAAACTAACCTAGG + Intergenic
973885564 4:55317585-55317607 TATCCTAAGCAAACTAACACAGG - Intergenic
974250863 4:59381192-59381214 TATCCTTAGCAAACTAACCCAGG + Intergenic
974361974 4:60893170-60893192 GAGACTAAGCAAACTGACCAAGG - Intergenic
974528299 4:63074802-63074824 TAGCCTCAGCAAACTAACACAGG - Intergenic
974759798 4:66260268-66260290 TATCCTAAGCAAACTAACACAGG - Intergenic
974914600 4:68164035-68164057 TATCCTAAGCAAACTAACGCAGG + Intergenic
974970913 4:68825605-68825627 TAGCCTTAGCAAACTAACATAGG - Intronic
974984873 4:69010787-69010809 TAGCCTTAGCAAACTAACATAGG + Intronic
974992149 4:69106366-69106388 TATCCTTAGCAAACTAACAAAGG - Intronic
975169828 4:71220984-71221006 TATCCTCAGCAAACTAACCCAGG - Intronic
975533574 4:75425608-75425630 TAGCCCAAGCAGACTAAACAGGG - Intergenic
975909615 4:79251350-79251372 TAGCCCAAGCAAACTAACACAGG + Intronic
976346250 4:84005087-84005109 TATCCTTAGCAAACTAACAAAGG + Intergenic
976452597 4:85208112-85208134 TATCCTAAGCAAACTAACACAGG + Intergenic
976640229 4:87330031-87330053 TAGCCTAAGCAAACTAACACAGG - Intergenic
977049868 4:92116225-92116247 TATCCTAAGCAAACTAACACAGG - Intergenic
977191618 4:94008137-94008159 TAGCCTCAGCAAACTAACGCAGG + Intergenic
977385997 4:96340094-96340116 TAACCTAAGTAAACCAATCCAGG + Intergenic
977582420 4:98740077-98740099 TAGCCTTAGCAAACTAACACAGG - Intergenic
977638942 4:99333194-99333216 TATCCTTAGCAAACTAACAAAGG - Intergenic
977903607 4:102451064-102451086 TATCCTAAGCAAACTAACACAGG + Intergenic
978133724 4:105232132-105232154 TATCCTAAACAAACTAACAAAGG - Intronic
978225804 4:106333625-106333647 TAGCTTCAGAAAACAAACCATGG + Intronic
978693778 4:111550323-111550345 TATCCTAAGCAAACTAACACAGG + Intergenic
978912557 4:114081916-114081938 TTGCATAAGAAAACCACCCAAGG - Intergenic
979267217 4:118717555-118717577 TATCCTAAGCAAATTAACAAAGG - Intergenic
979737177 4:124101595-124101617 TATCCTAAGCAAATCAACAGAGG - Intergenic
979741917 4:124161680-124161702 TATCCTAAGCAAACTAACACAGG + Intergenic
979761483 4:124410653-124410675 TAGCATAGGCAAGCCAAGCATGG - Intergenic
980392441 4:132164143-132164165 TATCCTCAGCAAACTAACAAAGG - Intergenic
985085764 4:186310766-186310788 TATCCTAAGCAAACTAACGCAGG - Intergenic
985093593 4:186389823-186389845 TATCCTAAGCAAACTAACTCAGG + Intergenic
986123505 5:4865403-4865425 TATCCAAAGCAAACTAACCCAGG + Intergenic
986520945 5:8617413-8617435 TAGCCTAAGCAAACTAATGCAGG - Intergenic
986557042 5:9020835-9020857 TATCCTAAGCAAATTAACAAAGG - Intergenic
986599913 5:9462701-9462723 TATCCTTAGCAAACCAACACAGG + Intronic
987477091 5:18403827-18403849 TAGCCTAAGCAAATTAACACAGG - Intergenic
987831128 5:23096682-23096704 TATCCTTAGCAAACTAACCCAGG + Intergenic
989291092 5:39766954-39766976 TATCCTTAGCAAACCAACGCAGG - Intergenic
989715878 5:44462409-44462431 TATCCTAAGCAAACTAATGAAGG - Intergenic
990228934 5:53689483-53689505 TATCCTCAGCAAACTAACAAAGG + Intergenic
990748519 5:58985907-58985929 TAGCCAAACCAAACTAACTAAGG + Intronic
991090051 5:62685538-62685560 TAGCTTAGGAAAACCAACCCTGG - Intergenic
991458989 5:66836669-66836691 TATCCTAAGCATACTAACAAAGG + Intronic
991985175 5:72277815-72277837 TATCCTCAGCAAACTAACCCAGG + Intronic
993089992 5:83413633-83413655 TATCCTCAGCAAACCAACACAGG + Intergenic
993194215 5:84720261-84720283 TATCCTTAGCAAACCAACACAGG + Intergenic
993296274 5:86145566-86145588 TATCCTTAGCAAACCAACAGGGG + Intergenic
993941428 5:94063206-94063228 GAGCCTGAGCAAGCCATCCAGGG + Intronic
994354217 5:98776713-98776735 TAGCCAAAGCAAAAGAACCCCGG + Intronic
995778625 5:115752293-115752315 TATCCTAAGCAAACTAACACAGG - Intergenic
996032530 5:118721809-118721831 TATCCTTAGCAAACTAACAAAGG + Intergenic
996180565 5:120414244-120414266 TATCCTAAGCAAACTAACACAGG + Intergenic
996305645 5:122044122-122044144 TATCCTAAGCAAACTAACACAGG - Intronic
996345531 5:122484380-122484402 TATCCTTAGCAAACTAACCCAGG - Intergenic
996486798 5:124044760-124044782 TAGCCTATGCAAACCTACAGGGG + Intergenic
996880468 5:128291170-128291192 TAGTCTAAGAAAAACAATCAAGG + Intronic
996955647 5:129180349-129180371 AAGCCTAACCATATCAACCAAGG - Intergenic
997750832 5:136344147-136344169 TATCCTAAGCAAACTAACACAGG + Intronic
998577391 5:143331657-143331679 TATCCTAAGCAAACTAACACAGG + Intronic
998586940 5:143437382-143437404 TGGGTTAAACAAACCAACCAAGG - Intergenic
998810569 5:145962245-145962267 TGGCCTGAGCAAAACTACCAGGG + Intronic
999429465 5:151513469-151513491 TATCCTAAGCAAACTAACACAGG + Intronic
999904884 5:156129755-156129777 CATCCTAAGCAAACCAACACAGG - Intronic
1000108847 5:158087801-158087823 TATCCTCAGCAAACTAACGAAGG - Intergenic
1000638095 5:163666509-163666531 TATCCTCAGCAAACCAACACAGG - Intergenic
1001178890 5:169499746-169499768 TATCCTAAGCAAACTAACATAGG - Intergenic
1001357886 5:171048746-171048768 TATCCTAAGCAAACTAACACAGG - Intronic
1001891179 5:175340381-175340403 TATCCTAAGCAAACTAACACAGG + Intergenic
1002907297 6:1459999-1460021 TATCCTAAGCAAACTAACACAGG - Intergenic
1003229804 6:4241777-4241799 TAGCCTCAGCAAACTAACCCAGG - Intergenic
1004574151 6:16876982-16877004 TATCCTAAGCAAACTAACGCAGG - Intergenic
1005199125 6:23323310-23323332 TATCCTAAGCAAACTAACACAGG + Intergenic
1005244890 6:23872524-23872546 TATCCTAAGCAAACTAACCCAGG + Intergenic
1007830980 6:44638152-44638174 TATCCTAAGCAAACTAACACAGG + Intergenic
1008269935 6:49479846-49479868 TATCCTAAGCAAACTAACACAGG + Intronic
1008345753 6:50424419-50424441 TATCCTTAGCAAACTAACAAAGG + Intergenic
1008781943 6:55118166-55118188 TATCCTAAGCAAACTAACTCAGG - Intronic
1009528077 6:64773247-64773269 TATCCTAAGCAAACCAACTTAGG - Intronic
1010477323 6:76304003-76304025 TATCCTAAGCAAATTAACAAGGG - Intergenic
1010659461 6:78552556-78552578 TATCCTAAGCAAATTAACCCAGG - Intergenic
1010849440 6:80753656-80753678 TATCCTAAGCAAACTAACACAGG - Intergenic
1011295521 6:85823243-85823265 TATCCTAAGCAAACTAACACAGG + Intergenic
1012203019 6:96429205-96429227 TATCCTCAGCAAACTAACCCAGG - Intergenic
1012238868 6:96849882-96849904 TATCCTAAGCAAACGAACATGGG + Intergenic
1012354953 6:98302556-98302578 TATCCTAAGCAAATTAACCCAGG - Intergenic
1012397989 6:98821902-98821924 TGACCTAAGCAGACCAATCAAGG - Intergenic
1012537525 6:100317013-100317035 TAGACTAAGAACAGCAACCATGG + Intergenic
1013816243 6:114101925-114101947 TATCCTAAGCAAACCAACTCAGG + Intronic
1014158916 6:118144313-118144335 TATCCTAAGCAAACTAACACAGG + Intronic
1014264724 6:119263377-119263399 TATCCTAAGCAAACTAACACAGG + Intronic
1014567596 6:122969391-122969413 TAGCCTAAGCAAATTAACACAGG - Intergenic
1015043371 6:128748460-128748482 TATCCTAAGCAAACTAACATAGG + Intergenic
1015162373 6:130168001-130168023 TAGCCTAAGCAGAGCAAAAATGG + Intronic
1015436990 6:133200858-133200880 TAGCAAAAGCAAACCAACTGTGG + Intergenic
1015470907 6:133605072-133605094 TATCCTAAGCAAACTAACACGGG - Intergenic
1017750169 6:157484018-157484040 TATCCTAAGCAAACTAACACAGG + Intronic
1017928147 6:158928244-158928266 TATCCTAAGCAAACTAACAAAGG - Intergenic
1018576355 6:165264178-165264200 TGGCCTAAGCAAACAAAGGAAGG + Intergenic
1020385701 7:7599903-7599925 TATCCTAAGCAAACTAACACAGG + Intronic
1020781196 7:12518662-12518684 AAGCCTGAGCACACCACCCAAGG - Intergenic
1022153838 7:27639314-27639336 TATCCTAAGCAAACTAATCCAGG + Intronic
1023505428 7:40895187-40895209 TATCCTAAGCAAACTAACACAGG + Intergenic
1024528069 7:50366001-50366023 TATCCTTAGCAAACTAACCCAGG + Intronic
1027353404 7:77334299-77334321 TATCCTCAGCAAACTAACAAAGG + Intronic
1028062363 7:86338874-86338896 AATCCTAAGCAAAAGAACCAAGG - Intergenic
1028161846 7:87494582-87494604 TATCCTAAGCAAACTAACGCAGG - Intergenic
1028323996 7:89499180-89499202 TATCCTTAGCAAACTAACAAAGG + Intergenic
1028817285 7:95160791-95160813 TATCCTAAGCAAACTAACACAGG - Intronic
1029250122 7:99230210-99230232 TATCCTAAGCAAACTAACGCAGG - Intergenic
1030971316 7:116060587-116060609 TAGCCTTAGCAAACAAACTCAGG + Intronic
1031026257 7:116683325-116683347 TATCCTTAGCAAACTAACAAAGG - Intronic
1031294872 7:119989008-119989030 TATCCTAAGAAAACCAACAGAGG + Intergenic
1031888595 7:127267148-127267170 TATCCTAAGCAAACTAACACAGG - Intergenic
1032807084 7:135366449-135366471 TAGACTAATCAAATCAAGCAAGG + Intronic
1033681614 7:143600969-143600991 TAGCCTCAGCAAACTAACACAGG + Intergenic
1033703278 7:143860844-143860866 TAGCCTCAGCAAACTAACACAGG - Intronic
1034064749 7:148125501-148125523 TATCCTAAGCAAACTAACACAGG - Intronic
1034389618 7:150775127-150775149 TATCCTAAGCAAACTAACACGGG + Intergenic
1034565075 7:151907334-151907356 TATCCTAAGCAAACTAACACAGG + Intergenic
1034693533 7:153033644-153033666 TATCCTTAGCAAACCAACACAGG - Intergenic
1035970823 8:4246288-4246310 TATGCTAAGCAAACTAACCCAGG - Intronic
1037155085 8:15689724-15689746 TATCCTAAGCAAACTAACACAGG - Intronic
1037316208 8:17601734-17601756 TATCCTAAGTAAACCAACACAGG - Intronic
1037524932 8:19715394-19715416 TATCCTAAGTAAACCAACACAGG - Intronic
1037541405 8:19875430-19875452 TATCCTAAGCAAACTAACACCGG - Intergenic
1038830616 8:31054986-31055008 TATCCTCAGCAAACTAACAAAGG - Intronic
1038854319 8:31314575-31314597 TATCCTAAGCAAACTAACACAGG + Intergenic
1039218224 8:35297507-35297529 TAGCCTCAGCCAACCTACAAAGG - Intronic
1039855403 8:41407777-41407799 AAGTCTGAGCCAACCAACCAAGG - Intergenic
1040407600 8:47121685-47121707 TATCCTAAGCAAACTAACGCAGG + Intergenic
1040422796 8:47256000-47256022 TTGACTAAGAAAACCAACTAAGG + Intergenic
1040635999 8:49273909-49273931 TAGCCTCAGCAAACTAACTCAGG + Intergenic
1040773570 8:51010938-51010960 TAACCTAAGCAAACTAACACAGG - Intergenic
1041065329 8:54077217-54077239 TATCCTAAGCAAACCATCACAGG + Intronic
1042105557 8:65322833-65322855 GTGCCAAAGCAAACCAAACAGGG + Intergenic
1042328211 8:67550308-67550330 TATCCTAAGCAAACTAACACAGG - Intronic
1042764883 8:72309980-72310002 TATCCTCAGCAAACTAACAAAGG - Intergenic
1042984048 8:74564213-74564235 TATCCTAAGCAAATTAACAAAGG - Intergenic
1043093318 8:75931897-75931919 TACCCTAAGCAAACTAACACAGG + Intergenic
1043214157 8:77564458-77564480 TATCCTCAGCAAACTAACAAAGG + Intergenic
1043221447 8:77670975-77670997 TATCCTAAGCAAACTAACACAGG + Intergenic
1043250139 8:78062337-78062359 TATCCTAAGCAAACTAACACAGG + Intergenic
1044216400 8:89616213-89616235 TAACATAAGCAAAACCACCATGG + Intergenic
1044351247 8:91169129-91169151 AATCCTAAGCAAACTAACCCAGG + Intronic
1045520629 8:102900037-102900059 TAGCAGCAGCAACCCAACCATGG - Intronic
1045676062 8:104608847-104608869 TATCCTAAGCAAACTAACACAGG - Intronic
1046165599 8:110430490-110430512 TAACCTCAGCAAACTAACCCAGG - Intergenic
1046290724 8:112156493-112156515 TATCCTTAGCAAACCAACGCAGG + Intergenic
1046432576 8:114148509-114148531 TATCCTAAGCAAACTAACACAGG - Intergenic
1046638475 8:116699424-116699446 TATCCTAAGCAAATTAACCTAGG + Intronic
1046851902 8:118984208-118984230 TATCCTAAGCAAACTAACACAGG + Intergenic
1046886164 8:119369591-119369613 TATCCTAAGCAAACTAACACAGG + Intergenic
1047130300 8:122012131-122012153 TATCCTAAGCAAACAAACACAGG - Intergenic
1047164653 8:122423722-122423744 TATCCTAAGCAAACTAACACTGG - Intergenic
1047269937 8:123347403-123347425 TATCCTATCCAAAGCAACCAGGG + Exonic
1047367081 8:124221542-124221564 TATCCTAAGCAAACTAACACAGG - Intergenic
1048600550 8:135915052-135915074 TATCCTAAGCAAACTAACACAGG + Intergenic
1048769268 8:137877991-137878013 TATCCTCAGCAAACCAACGCAGG - Intergenic
1049043183 8:140128336-140128358 TGGCGTAAGCAAGCCATCCATGG + Intronic
1049130269 8:140833491-140833513 AAGCCTTAGGAAACCAAACAGGG + Intronic
1049703859 8:144028927-144028949 TATCCTCAGCAAACTAACCCAGG + Intronic
1050031371 9:1389608-1389630 TATCCTAAGCAAACTAACATGGG - Intergenic
1050167125 9:2776985-2777007 TATCCTCAGCAAACTAACAAAGG + Intronic
1050346278 9:4691439-4691461 TATCCTAAGCAAACTAACAAAGG - Intronic
1050758864 9:9041480-9041502 TATCCTTAGCAAACTAACCCAGG - Intronic
1051301863 9:15660587-15660609 TATCCTAAGCAAATTAACAAAGG - Intronic
1051603828 9:18900649-18900671 TATCCTCAGCAAACTAACCCAGG + Intronic
1051687890 9:19677305-19677327 TAGCCTCAGCAAACTAACACAGG + Intronic
1052204590 9:25824040-25824062 TATCCTTAGCAAACGAACCCAGG - Intergenic
1052501220 9:29292790-29292812 TATCCTAAACAAACCAACACAGG - Intergenic
1052658922 9:31402984-31403006 TATCCTAAGCAAACTAACACAGG + Intergenic
1052685706 9:31752947-31752969 TAGCCTAGACCAACCAAGCATGG - Intergenic
1052795607 9:32920817-32920839 TATCCTAAGCAAACTAACGCAGG + Intergenic
1052885555 9:33644536-33644558 TATCCTCAGCAAACTAACCCAGG + Intergenic
1054960771 9:70966617-70966639 TATCCTTAGCAAACTAACAAAGG + Intronic
1055012872 9:71586311-71586333 GAGCCTAGGCAAATCATCCATGG - Intergenic
1055361971 9:75501256-75501278 TATCCTAAGCAAACTAACACAGG - Intergenic
1055709283 9:79041512-79041534 TAGCCAATGCAAGCCAACAAGGG - Intergenic
1055714000 9:79097580-79097602 TATCCTTAGCAAACCAACGCAGG - Intergenic
1056877907 9:90353084-90353106 TATCCTAAGCAAACTAACACAGG + Intergenic
1057697109 9:97331191-97331213 TATCCTAAGCAAACTAACAAAGG - Intronic
1058178037 9:101761083-101761105 TATCCTAAGCAAACTAACATAGG - Intergenic
1058414436 9:104771483-104771505 TATCCTCAGCAAACCAACAGAGG - Intronic
1058616590 9:106835171-106835193 TATCCTAAGCAAACTAACATAGG + Intergenic
1058669965 9:107352542-107352564 TATCCTAAGCAAACTAACGCAGG - Intergenic
1059797141 9:117710333-117710355 TATCCTAAGCAAATTAACAAAGG - Intronic
1059916857 9:119113564-119113586 TATCCTAAGTAAACTAACAAAGG + Intergenic
1203516796 Un_GL000213v1:8899-8921 TTGCCTAGGCAAACCAACATCGG + Intergenic
1185815640 X:3152709-3152731 TAGCCTTAGCAAACTAACACAGG + Intergenic
1186997221 X:15136600-15136622 TATCCTAAGCAAAGTAACTAAGG + Intergenic
1187054306 X:15727456-15727478 TATCCTAAGCAAACTAACACAGG - Intronic
1187302211 X:18061713-18061735 TAACCTTAGCAAACTAACGAGGG + Intergenic
1188227997 X:27625734-27625756 TATCCTAAGTAAACCAACCCAGG + Intronic
1188496804 X:30790586-30790608 TAGTCAAGGCAAACCAAACAAGG - Intergenic
1188775781 X:34216597-34216619 TATCCTAAGCAAACTAACACAGG + Intergenic
1188794578 X:34446004-34446026 TAGCCTTAGCAAACTAACATAGG + Intergenic
1188798073 X:34490920-34490942 TATCCTAAGCAAACTAACACAGG - Intergenic
1188826279 X:34839322-34839344 TATCCTAAGCAAACTAACACAGG - Intergenic
1188879375 X:35472840-35472862 TAACCTAAGCAAACTAACACAGG - Intergenic
1188900560 X:35727904-35727926 TATCCTAAGCAAACTAACACAGG - Intergenic
1191020446 X:55854271-55854293 TATCCTAAGCAAACCAAAGCAGG - Intergenic
1191130764 X:57007335-57007357 TATCCTAAGCAAACTAACTCAGG - Intergenic
1191810600 X:65183290-65183312 TATCCTAAGCAAACTAACGCAGG + Intergenic
1192415060 X:70972423-70972445 TAGCCTTAGCAAACTAACGCAGG + Intergenic
1192715622 X:73638794-73638816 TATCCTAAGCAAACTAACACAGG - Intronic
1193229389 X:79026221-79026243 TATCCTAAGCAAACTAACATAGG + Intergenic
1193637751 X:83973686-83973708 TACCCTCAGCAAACTAACCTAGG + Intergenic
1193727346 X:85058338-85058360 TATCCTCAGCAAACCAACACAGG - Intronic
1193843415 X:86438148-86438170 TATCCTAAGCAAACTAATGAAGG - Intronic
1193898844 X:87150033-87150055 TATCCTAAGCAAACTAACACTGG - Intergenic
1194179156 X:90691910-90691932 TATCCTAAGCAAACTAACATAGG + Intergenic
1194251416 X:91579857-91579879 TATCCTAAGCAAACTAACAAAGG - Intergenic
1194549585 X:95279924-95279946 TATCCTTAGCAAACTAACCCAGG + Intergenic
1195575593 X:106446543-106446565 TATCCTAAGCAAACTAACACAGG + Intergenic
1195979707 X:110564239-110564261 AATCCTAAGCAAACCAACACAGG + Intergenic
1196587798 X:117449784-117449806 TATCCTAAGCAAACTAACACAGG + Intergenic
1197115572 X:122828926-122828948 TATCCTTAGCAAACCAACACAGG + Intergenic
1197284546 X:124580990-124581012 TATCCTAAGCAAACTAACACAGG - Intronic
1197367246 X:125579271-125579293 TATCCTAAGCAAACTAACAATGG - Intergenic
1197391156 X:125866666-125866688 TATCCTAAGCAAACTAACGCAGG + Intergenic
1199567944 X:149235752-149235774 TATCCTCAGCAAACCAACGCAGG + Intergenic
1199747940 X:150786489-150786511 TATCCTAAGCAAACTAACTCAGG - Intronic
1199788368 X:151126424-151126446 TATCCTAAGCAAACTAACACAGG + Intergenic
1199966659 X:152825836-152825858 TATCCTCAGCAAACTAACCCAGG - Intergenic
1200525823 Y:4274077-4274099 TATCCTAAGCAAACTAACATAGG + Intergenic
1200570357 Y:4821088-4821110 TATCCAAAGCAAACTAACAAAGG - Intergenic
1200870662 Y:8094597-8094619 TTGCATAACCAAACCATCCATGG + Intergenic