ID: 924876768

View in Genome Browser
Species Human (GRCh38)
Location 1:248114917-248114939
Sequence ACTGACTGCGTGGATATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924876768_924876775 15 Left 924876768 1:248114917-248114939 CCACACATATCCACGCAGTCAGT No data
Right 924876775 1:248114955-248114977 TGGTCCCCATTGGCTGGAGTCGG No data
924876768_924876773 5 Left 924876768 1:248114917-248114939 CCACACATATCCACGCAGTCAGT No data
Right 924876773 1:248114945-248114967 TTACTGTGTGTGGTCCCCATTGG No data
924876768_924876770 -5 Left 924876768 1:248114917-248114939 CCACACATATCCACGCAGTCAGT No data
Right 924876770 1:248114935-248114957 TCAGTCCCTGTTACTGTGTGTGG No data
924876768_924876774 9 Left 924876768 1:248114917-248114939 CCACACATATCCACGCAGTCAGT No data
Right 924876774 1:248114949-248114971 TGTGTGTGGTCCCCATTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924876768 Original CRISPR ACTGACTGCGTGGATATGTG TGG (reversed) Intergenic