ID: 924876770

View in Genome Browser
Species Human (GRCh38)
Location 1:248114935-248114957
Sequence TCAGTCCCTGTTACTGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924876768_924876770 -5 Left 924876768 1:248114917-248114939 CCACACATATCCACGCAGTCAGT No data
Right 924876770 1:248114935-248114957 TCAGTCCCTGTTACTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924876770 Original CRISPR TCAGTCCCTGTTACTGTGTG TGG Intergenic