ID: 924876773

View in Genome Browser
Species Human (GRCh38)
Location 1:248114945-248114967
Sequence TTACTGTGTGTGGTCCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924876768_924876773 5 Left 924876768 1:248114917-248114939 CCACACATATCCACGCAGTCAGT No data
Right 924876773 1:248114945-248114967 TTACTGTGTGTGGTCCCCATTGG No data
924876769_924876773 -5 Left 924876769 1:248114927-248114949 CCACGCAGTCAGTCCCTGTTACT No data
Right 924876773 1:248114945-248114967 TTACTGTGTGTGGTCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924876773 Original CRISPR TTACTGTGTGTGGTCCCCAT TGG Intergenic