ID: 924876775

View in Genome Browser
Species Human (GRCh38)
Location 1:248114955-248114977
Sequence TGGTCCCCATTGGCTGGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924876768_924876775 15 Left 924876768 1:248114917-248114939 CCACACATATCCACGCAGTCAGT No data
Right 924876775 1:248114955-248114977 TGGTCCCCATTGGCTGGAGTCGG No data
924876772_924876775 -9 Left 924876772 1:248114941-248114963 CCTGTTACTGTGTGTGGTCCCCA No data
Right 924876775 1:248114955-248114977 TGGTCCCCATTGGCTGGAGTCGG No data
924876771_924876775 -8 Left 924876771 1:248114940-248114962 CCCTGTTACTGTGTGTGGTCCCC No data
Right 924876775 1:248114955-248114977 TGGTCCCCATTGGCTGGAGTCGG No data
924876769_924876775 5 Left 924876769 1:248114927-248114949 CCACGCAGTCAGTCCCTGTTACT No data
Right 924876775 1:248114955-248114977 TGGTCCCCATTGGCTGGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924876775 Original CRISPR TGGTCCCCATTGGCTGGAGT CGG Intergenic