ID: 924881504

View in Genome Browser
Species Human (GRCh38)
Location 1:248166089-248166111
Sequence CTGTATTTACCGAGGGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924881504_924881513 28 Left 924881504 1:248166089-248166111 CCAGGATCCCTCGGTAAATACAG No data
Right 924881513 1:248166140-248166162 CACTCTTAGGCCCTAGCAACTGG No data
924881504_924881508 1 Left 924881504 1:248166089-248166111 CCAGGATCCCTCGGTAAATACAG No data
Right 924881508 1:248166113-248166135 TTTCCGCACGCTCTTGTCAATGG No data
924881504_924881510 15 Left 924881504 1:248166089-248166111 CCAGGATCCCTCGGTAAATACAG No data
Right 924881510 1:248166127-248166149 TGTCAATGGCACCCACTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924881504 Original CRISPR CTGTATTTACCGAGGGATCC TGG (reversed) Intergenic
No off target data available for this crispr