ID: 924883403

View in Genome Browser
Species Human (GRCh38)
Location 1:248187751-248187773
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883398_924883403 -10 Left 924883398 1:248187738-248187760 CCAGTTCACCTCCCTCTCTGAGC No data
Right 924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG No data
924883395_924883403 8 Left 924883395 1:248187720-248187742 CCCGGGTGAGGCATAGACCCAGT No data
Right 924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG No data
924883397_924883403 -9 Left 924883397 1:248187737-248187759 CCCAGTTCACCTCCCTCTCTGAG No data
Right 924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG No data
924883396_924883403 7 Left 924883396 1:248187721-248187743 CCGGGTGAGGCATAGACCCAGTT No data
Right 924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883403 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr