ID: 924883415

View in Genome Browser
Species Human (GRCh38)
Location 1:248187816-248187838
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883409_924883415 6 Left 924883409 1:248187787-248187809 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG No data
924883410_924883415 -10 Left 924883410 1:248187803-248187825 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG No data
924883408_924883415 7 Left 924883408 1:248187786-248187808 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883415 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr