ID: 924883427

View in Genome Browser
Species Human (GRCh38)
Location 1:248187881-248187903
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883422_924883427 -10 Left 924883422 1:248187868-248187890 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG No data
924883420_924883427 7 Left 924883420 1:248187851-248187873 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG No data
924883421_924883427 6 Left 924883421 1:248187852-248187874 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883427 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr