ID: 924883439

View in Genome Browser
Species Human (GRCh38)
Location 1:248187946-248187968
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883433_924883439 6 Left 924883433 1:248187917-248187939 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG No data
924883434_924883439 -10 Left 924883434 1:248187933-248187955 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG No data
924883432_924883439 7 Left 924883432 1:248187916-248187938 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883439 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr