ID: 924883491

View in Genome Browser
Species Human (GRCh38)
Location 1:248188207-248188229
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883484_924883491 7 Left 924883484 1:248188177-248188199 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG No data
924883485_924883491 6 Left 924883485 1:248188178-248188200 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG No data
924883486_924883491 -10 Left 924883486 1:248188194-248188216 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883491 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr