ID: 924883503

View in Genome Browser
Species Human (GRCh38)
Location 1:248188272-248188294
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883498_924883503 -10 Left 924883498 1:248188259-248188281 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG No data
924883496_924883503 7 Left 924883496 1:248188242-248188264 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG No data
924883497_924883503 6 Left 924883497 1:248188243-248188265 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883503 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr