ID: 924883515

View in Genome Browser
Species Human (GRCh38)
Location 1:248188337-248188359
Sequence CTCTCTGAGCAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883509_924883515 6 Left 924883509 1:248188308-248188330 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG No data
924883508_924883515 7 Left 924883508 1:248188307-248188329 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG No data
924883510_924883515 -10 Left 924883510 1:248188324-248188346 CCAGTGCACCTGCCTCTCTGAGC No data
Right 924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883515 Original CRISPR CTCTCTGAGCAGAAGCAGGA GGG Intergenic
No off target data available for this crispr