ID: 924883527

View in Genome Browser
Species Human (GRCh38)
Location 1:248188402-248188424
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883522_924883527 -10 Left 924883522 1:248188389-248188411 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG No data
924883521_924883527 6 Left 924883521 1:248188373-248188395 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG No data
924883520_924883527 7 Left 924883520 1:248188372-248188394 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883527 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr