ID: 924883539

View in Genome Browser
Species Human (GRCh38)
Location 1:248188467-248188489
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883534_924883539 -10 Left 924883534 1:248188454-248188476 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG No data
924883533_924883539 6 Left 924883533 1:248188438-248188460 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG No data
924883532_924883539 7 Left 924883532 1:248188437-248188459 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883539 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr