ID: 924883551

View in Genome Browser
Species Human (GRCh38)
Location 1:248188532-248188554
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883545_924883551 6 Left 924883545 1:248188503-248188525 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG No data
924883546_924883551 -10 Left 924883546 1:248188519-248188541 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG No data
924883544_924883551 7 Left 924883544 1:248188502-248188524 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883551 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr