ID: 924883563

View in Genome Browser
Species Human (GRCh38)
Location 1:248188597-248188619
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883558_924883563 -10 Left 924883558 1:248188584-248188606 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG No data
924883557_924883563 6 Left 924883557 1:248188568-248188590 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG No data
924883556_924883563 7 Left 924883556 1:248188567-248188589 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883563 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr