ID: 924883575

View in Genome Browser
Species Human (GRCh38)
Location 1:248188662-248188684
Sequence CTCTCTGAGCAGAAGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883568_924883575 7 Left 924883568 1:248188632-248188654 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG No data
924883569_924883575 6 Left 924883569 1:248188633-248188655 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG No data
924883570_924883575 -10 Left 924883570 1:248188649-248188671 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883575 Original CRISPR CTCTCTGAGCAGAAGCAGGA TGG Intergenic
No off target data available for this crispr