ID: 924883592

View in Genome Browser
Species Human (GRCh38)
Location 1:248188762-248188784
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883592_924883600 8 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883600 1:248188793-248188815 TCTCTGAGCAGAAGCAGGATGGG No data
924883592_924883596 3 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883596 1:248188788-248188810 CTCCCTCTCTGAGCAGAAGCAGG No data
924883592_924883602 25 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883602 1:248188810-248188832 GATGGGACATTGCTTTGCCCGGG No data
924883592_924883601 24 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883601 1:248188809-248188831 GGATGGGACATTGCTTTGCCCGG No data
924883592_924883599 7 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG No data
924883592_924883603 30 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883603 1:248188815-248188837 GACATTGCTTTGCCCGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883592 Original CRISPR CACTGGTCTATGCCTCACCC GGG (reversed) Intergenic
No off target data available for this crispr