ID: 924883596

View in Genome Browser
Species Human (GRCh38)
Location 1:248188788-248188810
Sequence CTCCCTCTCTGAGCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883593_924883596 2 Left 924883593 1:248188763-248188785 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883596 1:248188788-248188810 CTCCCTCTCTGAGCAGAAGCAGG No data
924883592_924883596 3 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883596 1:248188788-248188810 CTCCCTCTCTGAGCAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883596 Original CRISPR CTCCCTCTCTGAGCAGAAGC AGG Intergenic
No off target data available for this crispr