ID: 924883600

View in Genome Browser
Species Human (GRCh38)
Location 1:248188793-248188815
Sequence TCTCTGAGCAGAAGCAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883592_924883600 8 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883600 1:248188793-248188815 TCTCTGAGCAGAAGCAGGATGGG No data
924883594_924883600 -9 Left 924883594 1:248188779-248188801 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883600 1:248188793-248188815 TCTCTGAGCAGAAGCAGGATGGG No data
924883593_924883600 7 Left 924883593 1:248188763-248188785 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883600 1:248188793-248188815 TCTCTGAGCAGAAGCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883600 Original CRISPR TCTCTGAGCAGAAGCAGGAT GGG Intergenic
No off target data available for this crispr