ID: 924883601

View in Genome Browser
Species Human (GRCh38)
Location 1:248188809-248188831
Sequence GGATGGGACATTGCTTTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883592_924883601 24 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883601 1:248188809-248188831 GGATGGGACATTGCTTTGCCCGG No data
924883597_924883601 -4 Left 924883597 1:248188790-248188812 CCCTCTCTGAGCAGAAGCAGGAT No data
Right 924883601 1:248188809-248188831 GGATGGGACATTGCTTTGCCCGG No data
924883598_924883601 -5 Left 924883598 1:248188791-248188813 CCTCTCTGAGCAGAAGCAGGATG No data
Right 924883601 1:248188809-248188831 GGATGGGACATTGCTTTGCCCGG No data
924883595_924883601 -1 Left 924883595 1:248188787-248188809 CCTCCCTCTCTGAGCAGAAGCAG No data
Right 924883601 1:248188809-248188831 GGATGGGACATTGCTTTGCCCGG No data
924883594_924883601 7 Left 924883594 1:248188779-248188801 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883601 1:248188809-248188831 GGATGGGACATTGCTTTGCCCGG No data
924883593_924883601 23 Left 924883593 1:248188763-248188785 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883601 1:248188809-248188831 GGATGGGACATTGCTTTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883601 Original CRISPR GGATGGGACATTGCTTTGCC CGG Intergenic
No off target data available for this crispr