ID: 924883602

View in Genome Browser
Species Human (GRCh38)
Location 1:248188810-248188832
Sequence GATGGGACATTGCTTTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924883594_924883602 8 Left 924883594 1:248188779-248188801 CCAGTGCACCTCCCTCTCTGAGC No data
Right 924883602 1:248188810-248188832 GATGGGACATTGCTTTGCCCGGG No data
924883592_924883602 25 Left 924883592 1:248188762-248188784 CCCGGGTGAGGCATAGACCAGTG No data
Right 924883602 1:248188810-248188832 GATGGGACATTGCTTTGCCCGGG No data
924883595_924883602 0 Left 924883595 1:248188787-248188809 CCTCCCTCTCTGAGCAGAAGCAG No data
Right 924883602 1:248188810-248188832 GATGGGACATTGCTTTGCCCGGG No data
924883597_924883602 -3 Left 924883597 1:248188790-248188812 CCCTCTCTGAGCAGAAGCAGGAT No data
Right 924883602 1:248188810-248188832 GATGGGACATTGCTTTGCCCGGG No data
924883598_924883602 -4 Left 924883598 1:248188791-248188813 CCTCTCTGAGCAGAAGCAGGATG No data
Right 924883602 1:248188810-248188832 GATGGGACATTGCTTTGCCCGGG No data
924883593_924883602 24 Left 924883593 1:248188763-248188785 CCGGGTGAGGCATAGACCAGTGC No data
Right 924883602 1:248188810-248188832 GATGGGACATTGCTTTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924883602 Original CRISPR GATGGGACATTGCTTTGCCC GGG Intergenic
No off target data available for this crispr