ID: 924884201

View in Genome Browser
Species Human (GRCh38)
Location 1:248194922-248194944
Sequence CTGTATTTACCGAGGGATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924884201_924884205 1 Left 924884201 1:248194922-248194944 CCGGTATCCCTCGGTAAATACAG No data
Right 924884205 1:248194946-248194968 TTTTTGCAAGCTTTTGACAATGG No data
924884201_924884208 28 Left 924884201 1:248194922-248194944 CCGGTATCCCTCGGTAAATACAG No data
Right 924884208 1:248194973-248194995 CACTCTTACACCCTAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924884201 Original CRISPR CTGTATTTACCGAGGGATAC CGG (reversed) Intergenic
No off target data available for this crispr