ID: 924896960

View in Genome Browser
Species Human (GRCh38)
Location 1:248349438-248349460
Sequence ACCGTGCTCGGGTTTCCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924896960 Original CRISPR ACCGTGCTCGGGTTTCCAAG AGG Exonic
900483134 1:2909012-2909034 ACCCAGCTCTGGCTTCCAAGGGG + Intergenic
902335065 1:15749815-15749837 ACTGGGCTCTGGGTTCCAAGCGG + Intergenic
910549122 1:88456006-88456028 CCCTTGCGCGGTTTTCCAAGCGG + Intergenic
924896960 1:248349438-248349460 ACCGTGCTCGGGTTTCCAAGAGG + Exonic
1074686644 10:115968132-115968154 ACCGTGCACACATTTCCAAGTGG + Intergenic
1077008620 11:370308-370330 ACCCTGCTGAGGCTTCCAAGAGG + Intronic
1077130297 11:968649-968671 ACGGTGCTGGGGCTTCCCAGTGG + Intronic
1080493598 11:32794475-32794497 TCCTTGCTCTGGTTGCCAAGGGG - Intronic
1117084902 14:52189788-52189810 ACCCTGCTAGAGTTTTCAAGTGG - Intergenic
1124555249 15:30719336-30719358 AGAGAGCTCAGGTTTCCAAGTGG - Intronic
1124676006 15:31686345-31686367 AGAGAGCTCAGGTTTCCAAGTGG + Intronic
1140909217 16:79436770-79436792 ACCCAGCTCATGTTTCCAAGAGG - Intergenic
1141134880 16:81458591-81458613 ACAGTGTGCGGGTTTCAAAGTGG - Intronic
1144484728 17:15655320-15655342 ATCCTGCTTGGGTTTCCACGTGG + Intronic
1147405787 17:40211050-40211072 ACCGTGCTCAGTCTTCAAAGGGG - Intergenic
1152068549 17:78124334-78124356 ATCGTGCTGGGGTTCCCATGGGG - Intronic
1164264881 19:23605996-23606018 GCCTTGCACTGGTTTCCAAGGGG + Intronic
1164990924 19:32683184-32683206 GCTGTGCTCGTGTTTCCCAGTGG - Intergenic
926312105 2:11682254-11682276 ACTGTGGTTGGGTTTCCAGGTGG - Intronic
936358848 2:111777359-111777381 ACCCAGCTCGAGTTTCCCAGAGG - Intronic
937553016 2:123118148-123118170 ATCTTGCTCTGGTTTTCAAGGGG + Intergenic
939132249 2:138250263-138250285 ACCATGCTAAAGTTTCCAAGTGG + Intergenic
1169745159 20:8935835-8935857 ACAGTCCTCAGGGTTCCAAGTGG - Intronic
1170874536 20:20237705-20237727 TCCGTGCTCAGTTTTCCCAGTGG + Intronic
1177189935 21:17839618-17839640 ACCCAGCTAGTGTTTCCAAGGGG + Intergenic
1178892843 21:36534395-36534417 ACCTTGCTCTGGTTCCCACGGGG - Intronic
1179225065 21:39445775-39445797 CCCGCGCGCGGGTTTCCATGGGG - Intronic
1181335938 22:22128472-22128494 ACAGTTCTTGGGGTTCCAAGAGG - Intergenic
1185348470 22:50321044-50321066 GCCCTGCTCGGGGTTCCATGAGG + Intronic
957531309 3:81443588-81443610 ACTGTGCACTGGTTACCAAGCGG - Intergenic
988324260 5:29741526-29741548 TCCTTGCTCCAGTTTCCAAGGGG - Intergenic
1002090094 5:176799213-176799235 ACCCTGCTTGGGTCTCCCAGGGG + Intergenic
1003059857 6:2854382-2854404 ATTGTGCTTGGGTTTCCAAATGG + Intergenic
1011341952 6:86325801-86325823 ACCGTTCTACTGTTTCCAAGTGG + Intergenic
1018349751 6:162943878-162943900 ACAATCCTCTGGTTTCCAAGTGG - Intronic
1020804102 7:12767051-12767073 ACCGTGCCCGGCCTTCAAAGTGG - Intergenic
1039007274 8:33053688-33053710 ACCTTGTACTGGTTTCCAAGGGG - Intergenic
1047605903 8:126474097-126474119 ACAGTGCTCTGGTCTCCAACTGG - Intergenic
1051242950 9:15079573-15079595 ACAGTGCTGGGGTCTTCAAGAGG - Intergenic
1051889131 9:21925214-21925236 AAAGTGGTGGGGTTTCCAAGAGG - Intronic
1188261539 X:28030554-28030576 ACTGTGCTGGGATTTCCAACAGG + Intergenic
1195016454 X:100786366-100786388 ACCCTGCTGGAGTTTCTAAGAGG - Intergenic
1195284447 X:103370232-103370254 GGCTTGCTCAGGTTTCCAAGAGG - Intergenic