ID: 924896960

View in Genome Browser
Species Human (GRCh38)
Location 1:248349438-248349460
Sequence ACCGTGCTCGGGTTTCCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924896960 Original CRISPR ACCGTGCTCGGGTTTCCAAG AGG Exonic