ID: 924904453

View in Genome Browser
Species Human (GRCh38)
Location 1:248436981-248437003
Sequence TTATGAGGTACCTAACAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924904453_924904457 3 Left 924904453 1:248436981-248437003 CCACCTTGTTAGGTACCTCATAA No data
Right 924904457 1:248437007-248437029 TCTCTAAAAATGGTTTAGTTAGG No data
924904453_924904456 -7 Left 924904453 1:248436981-248437003 CCACCTTGTTAGGTACCTCATAA No data
Right 924904456 1:248436997-248437019 CTCATAAGCATCTCTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924904453 Original CRISPR TTATGAGGTACCTAACAAGG TGG (reversed) Intergenic
No off target data available for this crispr