ID: 924905959

View in Genome Browser
Species Human (GRCh38)
Location 1:248452947-248452969
Sequence TGTGGAGGCGGGAGTCCATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 2, 1: 2, 2: 0, 3: 25, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924905959_924905966 16 Left 924905959 1:248452947-248452969 CCACATGGACTCCCGCCTCCACA 0: 2
1: 2
2: 0
3: 25
4: 184
Right 924905966 1:248452986-248453008 GCTCAGCCAGCTCTCCATCATGG 0: 2
1: 3
2: 5
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924905959 Original CRISPR TGTGGAGGCGGGAGTCCATG TGG (reversed) Exonic