ID: 924908766

View in Genome Browser
Species Human (GRCh38)
Location 1:248486144-248486166
Sequence GTACAGAAGAAGAATGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 2, 1: 0, 2: 3, 3: 46, 4: 385}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924908760_924908766 27 Left 924908760 1:248486094-248486116 CCCCAAGTTAAACATGCATTAAG 0: 2
1: 0
2: 0
3: 17
4: 194
Right 924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG 0: 2
1: 0
2: 3
3: 46
4: 385
924908762_924908766 25 Left 924908762 1:248486096-248486118 CCAAGTTAAACATGCATTAAGCA 0: 2
1: 0
2: 1
3: 12
4: 139
Right 924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG 0: 2
1: 0
2: 3
3: 46
4: 385
924908761_924908766 26 Left 924908761 1:248486095-248486117 CCCAAGTTAAACATGCATTAAGC 0: 2
1: 0
2: 2
3: 13
4: 183
Right 924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG 0: 2
1: 0
2: 3
3: 46
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924908766 Original CRISPR GTACAGAAGAAGAATGAACA GGG Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
902183234 1:14705537-14705559 CAACAGCAGATGAATGAACAAGG + Intronic
902601446 1:17542156-17542178 GAAAAGAAGAAGATTGAGCATGG + Intronic
902675612 1:18006562-18006584 GAACAGAAGAAGGAAGGACATGG + Intergenic
902967297 1:20015641-20015663 GAACAGACCAATAATGAACAAGG - Intergenic
903090011 1:20905787-20905809 GTACTATAGAAGGATGAACAAGG + Intronic
903465717 1:23551459-23551481 GGAAAGAAGAAGAAGGAATAAGG + Intergenic
903471779 1:23592273-23592295 GTGCAGGAGAGGAAGGAACATGG + Intronic
904027064 1:27510848-27510870 GTAAAGAATAAGAGTTAACAGGG - Intergenic
905503823 1:38460527-38460549 GTAGAGAAAAAGAATAAAAAAGG + Intergenic
907200437 1:52721959-52721981 GTAAAAAAGAAGAACGAGCATGG - Intergenic
907593426 1:55697710-55697732 GTGCAGAAGAATAATGATCTTGG - Intergenic
907754801 1:57301235-57301257 GTACAGAGGGAGATTAAACAAGG + Intronic
908047677 1:60188285-60188307 AAAAAGAAGAACAATGAACAAGG + Intergenic
908535198 1:65069997-65070019 GAACAGAAAAAAAAAGAACATGG + Intergenic
909186684 1:72495568-72495590 GTACAGATGAAGAAATAATATGG - Intergenic
909511874 1:76462401-76462423 GTAGAAAATAAGAATGCACAAGG - Intronic
911289131 1:96034809-96034831 GTACAAAACAAAAATTAACAGGG + Intergenic
912243698 1:107938769-107938791 GAACAAAAGAACAATGAAAAAGG + Intronic
912671389 1:111630679-111630701 GTATATAAGAAGAATGAACCAGG + Intronic
914388796 1:147199157-147199179 GAACAGAAGAAGAAGGAAAATGG + Intronic
917346605 1:174034542-174034564 GCACAGAAAAAGAAAAAACATGG - Intergenic
918961880 1:191289728-191289750 GGATAGAAGATGAATGAAAATGG + Intergenic
919160869 1:193828952-193828974 TCTCAGAAGAAGAATGATCAGGG - Intergenic
919642614 1:200060139-200060161 GGACAGAAGAAAAGTGGACAAGG - Intronic
920719255 1:208371726-208371748 GTAAAGCAGAAGAAAGAGCAAGG - Intergenic
920723839 1:208415243-208415265 GTACAGCAGAAGTATGTGCAAGG - Intergenic
920832107 1:209474880-209474902 GCACAGCAGGAGAATGAACAGGG + Intergenic
921541364 1:216420168-216420190 AAACAGAAGAAAAATGAATAGGG - Intronic
923566633 1:235081304-235081326 ATCCACAACAAGAATGAACATGG + Intergenic
923633297 1:235670035-235670057 GTACAGAGCAAGAAAGACCAAGG - Intronic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924429171 1:243982129-243982151 GGAAAGAAGAAAAGTGAACAGGG - Intergenic
924715773 1:246572392-246572414 GAAGAGAAAAATAATGAACAAGG - Intronic
924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG + Intergenic
924915341 1:248561918-248561940 GTACAGAAGAAGAATGAACAGGG - Intergenic
1063847017 10:10141403-10141425 GCTCCGAAGAAGAATCAACAGGG - Intergenic
1063862749 10:10329519-10329541 GGTCAGAAAAAGAATGAACCTGG - Intergenic
1064379885 10:14832070-14832092 GCAAAGAAGAAAAATAAACATGG + Intronic
1065187394 10:23181732-23181754 GTACAGAAGAAAAAAGAAAAAGG - Intergenic
1066424006 10:35288891-35288913 ATTCTGAAGAAGAATGAACTTGG - Intronic
1068318966 10:55384601-55384623 TTAGAGAAGAAGAAAGAACCAGG - Intronic
1068687742 10:59886842-59886864 GTACAGAAAAAGAATACAAATGG + Intronic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1070394709 10:76002184-76002206 CCTCAGAAGAAGAGTGAACAGGG - Intronic
1070529205 10:77321770-77321792 TTACTGAAGCAGAAAGAACATGG - Intronic
1071163843 10:82782091-82782113 GTACTGAAGAAGAATGGAGTTGG - Intronic
1071958942 10:90789360-90789382 GTAAAGAAGAAAAAATAACAAGG + Intronic
1072304677 10:94095851-94095873 ACACAGAAGTAGAAGGAACATGG - Intronic
1072533827 10:96344447-96344469 GTACAGAAGAAAAAAAAAAAAGG + Exonic
1072628586 10:97130265-97130287 ATACCGAAGAGGAATGTACAGGG + Intronic
1073175742 10:101556208-101556230 GTACAGAAGAAAAATAAAAAAGG - Exonic
1073920277 10:108450519-108450541 GTACAGAAGGTTACTGAACAAGG + Intergenic
1073945198 10:108742318-108742340 GTACTCAAGAGGAATGAAGAGGG - Intergenic
1074892744 10:117749001-117749023 GTCCAGAGCAGGAATGAACAGGG - Intergenic
1075479730 10:122769550-122769572 GAAGAGAAGAAGAAGAAACAGGG - Intergenic
1075500864 10:122972826-122972848 GTACAAAAAGAGGATGAACATGG + Intronic
1077679865 11:4228860-4228882 CTACAGAAGAAGAATGATGCTGG + Intergenic
1077699758 11:4430784-4430806 GTACACAAGAATAAGTAACAAGG - Intergenic
1078936708 11:15957631-15957653 GTAAACAAGAAAAATGAAAAGGG + Intergenic
1078959246 11:16245171-16245193 TTACCAAAGAAGAAAGAACAAGG - Intronic
1079679507 11:23276616-23276638 CTAAAGAAGAAGAATGAAAATGG + Intergenic
1079888327 11:26017120-26017142 GTAAGGCAGAAGAATGAACTTGG + Intergenic
1080118948 11:28653275-28653297 ATACAGAAGAAAAATCAGCAAGG - Intergenic
1081430139 11:42967769-42967791 GTACAGTAGCAGATGGAACATGG + Intergenic
1081599349 11:44482053-44482075 GTGCACACAAAGAATGAACAAGG + Intergenic
1082642664 11:55684175-55684197 GTAGATAAGAAGACTGAACATGG - Intergenic
1085554042 11:77403280-77403302 GTTCAGAAGAAGATTGAACCTGG - Intronic
1085837648 11:79973785-79973807 CTACAACAGAAGTATGAACAGGG + Intergenic
1087124331 11:94608125-94608147 GTCCATAACCAGAATGAACATGG + Intronic
1087176283 11:95099120-95099142 GTATAGAACAAGACTGTACAAGG - Intronic
1088107308 11:106221977-106221999 GGACACAAGAAAAATGAGCATGG + Intergenic
1088410003 11:109523629-109523651 GTCCGCAAGAAGAAAGAACAGGG - Intergenic
1088549642 11:110999424-110999446 TTACAGAAGAAGTATAAAAATGG + Intergenic
1089022042 11:115226282-115226304 ATACAGATGATGCATGAACATGG + Intronic
1090062556 11:123476611-123476633 CAACAGCAGAAAAATGAACAAGG - Intergenic
1090494448 11:127196211-127196233 GTACACAAGAAGAAAGGAGAAGG - Intergenic
1092099191 12:5869280-5869302 GCACAGAAGAGTAATGAGCAGGG - Intronic
1094191320 12:27701222-27701244 GTAAAGAAAAAGCATGATCAGGG + Intergenic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1095202934 12:39406687-39406709 GAACAAAAGATGAATTAACATGG - Intronic
1095306653 12:40646315-40646337 GGACAGAAGAAAAAAAAACATGG + Intergenic
1095545188 12:43359552-43359574 TTACAAAAGAAGAATGAAGCTGG + Intronic
1096451651 12:51747798-51747820 GGACAGAAAGAGAAAGAACAGGG - Intronic
1098620091 12:72585489-72585511 GTTCAGAAGATCAATGAATATGG - Intronic
1099260930 12:80382054-80382076 GTATAGAAAAAGAATGGCCAGGG + Intergenic
1099925191 12:89008512-89008534 GGAGAGAAAAAGAATGAAAAAGG - Intergenic
1100023463 12:90099138-90099160 GTACACAAGAAGAATAACCATGG - Intergenic
1100264580 12:92963257-92963279 GAACAGAAGAAGAAGGTACAAGG - Intergenic
1101230489 12:102736404-102736426 GTTCAGAAGAAGTATGAAGAGGG - Intergenic
1101637417 12:106556407-106556429 GTACAGAAAATGAATGTACAAGG + Intronic
1103275195 12:119705410-119705432 GTACAGTGGGAGAATGAAGATGG + Intronic
1104646231 12:130499570-130499592 GTGCAGGAGTAGAATGAACACGG - Intronic
1105013712 12:132773298-132773320 GGACAGAAGAAGGAGGAAGAAGG + Intronic
1105492920 13:20904950-20904972 GTAGAGAAAATGAATTAACAAGG + Intergenic
1106484991 13:30164230-30164252 ATGCATGAGAAGAATGAACAGGG + Intergenic
1106616430 13:31333999-31334021 GCACAGGAGAAGAATTAACAAGG + Intergenic
1106753463 13:32797676-32797698 AAACAGAAGAAGAAGAAACATGG + Intergenic
1106938934 13:34754811-34754833 GAACTGAGGAAGAATGGACAGGG - Intergenic
1107174953 13:37389178-37389200 GTACCCAAGAAGAATGGAGATGG + Intergenic
1108552145 13:51557177-51557199 ATACAAAAGAAGAATGGAAAAGG - Intergenic
1108691807 13:52865843-52865865 GAGCAAAAGAAAAATGAACAAGG - Intergenic
1109077212 13:57851495-57851517 GTAAAAAAGAAGAATGAAACTGG - Intergenic
1109935738 13:69281721-69281743 GTTCATAAGAAGAATGATTAAGG + Intergenic
1114228066 14:20756702-20756724 GTACAGGAGCAGAAGAAACAAGG + Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1115782081 14:36780873-36780895 ATCCAGAAAAAGAATCAACAAGG - Intronic
1118393319 14:65314908-65314930 GTGGAAAAGAAGAATGCACATGG + Intergenic
1119198538 14:72735475-72735497 GCACAGTAGAAGAATCAAGAGGG + Intronic
1119370699 14:74139272-74139294 ATACAGAGGAAGAGGGAACATGG + Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119981774 14:79089757-79089779 GTGCAGAAGAAGAAAGATCTTGG - Intronic
1121003136 14:90466232-90466254 CCACAGGAGAAGAATGACCAAGG + Intergenic
1121073541 14:91047227-91047249 GAAAATAAGAAGAAAGAACAAGG + Intronic
1121492840 14:94372246-94372268 GTACAGAAGGAGAAGGAAGAGGG - Intergenic
1121868303 14:97383540-97383562 GTACCGAAAATGAATGAACCAGG + Intergenic
1122298004 14:100716316-100716338 AAACAGAAGAAGAATGCACAAGG - Intergenic
1122669987 14:103363946-103363968 GGACTGAAGAAGAGTAAACAGGG - Intergenic
1124105862 15:26737267-26737289 GTACAAAACAAGACTGAGCATGG + Intronic
1124949087 15:34299742-34299764 GTACAAAAGAGTAATAAACAAGG + Intronic
1127277960 15:57463963-57463985 CTACAGTAGAAGAATGGCCAGGG - Intronic
1128517801 15:68354068-68354090 GTACAGAATCAGCATGCACAGGG - Intronic
1130367853 15:83256814-83256836 TTACAGAACAAGAATTAACAAGG + Exonic
1130765089 15:86862023-86862045 GTACACAAGCAGAAGGAACAGGG - Intronic
1130904729 15:88232361-88232383 GTACAGCAGAGGAATAAACTAGG - Intronic
1130973122 15:88750774-88750796 GTATACAAGAGGAAAGAACAAGG - Intergenic
1131286775 15:91065902-91065924 GGACAGAAGAAGACTGTACTGGG + Intergenic
1131505285 15:93012695-93012717 GTACAGAAGAAAAATGCAAATGG - Intronic
1131734618 15:95318920-95318942 CTACAGAGGAAGAAGGTACAAGG - Intergenic
1132709527 16:1260202-1260224 GTCCAGGTGCAGAATGAACACGG + Intergenic
1134247100 16:12548139-12548161 GCCAAGATGAAGAATGAACAGGG - Intronic
1134320717 16:13160219-13160241 GTACAGATGAAGGATTAACATGG + Intronic
1135412569 16:22246229-22246251 GTACAGAAGAAGACTGGGCATGG + Intronic
1135706239 16:24677463-24677485 GAGCAAAAGAAAAATGAACATGG - Intergenic
1135833767 16:25804287-25804309 ATGCAGAAGAAAAATGAAAAAGG - Intronic
1135866043 16:26102965-26102987 GTGCAGAAGTGGAAAGAACATGG + Intronic
1136190153 16:28610597-28610619 GCATAGAACAAGAAAGAACAAGG + Intronic
1138709900 16:58959950-58959972 GTACTGAACAAGCATGAACAAGG + Intergenic
1138854685 16:60675414-60675436 ATTCAGTTGAAGAATGAACAGGG - Intergenic
1140413169 16:74753735-74753757 GGACAGAAGAAAAATGGAGATGG - Intronic
1140748854 16:78005277-78005299 GTAGAGGAGGAGAATGAACTTGG + Intergenic
1141200406 16:81893376-81893398 CTGCAGAAGATGAATTAACAAGG - Intronic
1143687332 17:8528487-8528509 GTACAGAAGAGAAAGGAACAGGG - Intronic
1143812369 17:9482261-9482283 GTACAGATGAAATATGAACGAGG - Intronic
1144041397 17:11414140-11414162 GTACAGAAGAAAGATGAGGAAGG - Intronic
1144243512 17:13337904-13337926 GTTCAGAATAAAAATGAACGGGG - Intergenic
1144644128 17:16958229-16958251 GTATAGAAAAAGAAAGAAAAAGG + Intronic
1145057486 17:19713035-19713057 GTACATAATATAAATGAACAAGG + Intronic
1145179811 17:20737255-20737277 GGACAGAGGAAAAATAAACATGG + Intergenic
1146320128 17:31840461-31840483 CAACAGAAGAGGAATGAATATGG + Intergenic
1146713351 17:35062102-35062124 GAGCATAAAAAGAATGAACAAGG + Intronic
1146964451 17:37013057-37013079 TTACAGAAGGAAAATGAATAAGG + Intronic
1147875229 17:43616311-43616333 GTACAGAGGAAGAAGCCACAGGG - Intergenic
1148516865 17:48227253-48227275 GCACAGAACAAGAATAAACAGGG - Intronic
1148519694 17:48260922-48260944 GAACAGAAGAAGAATGTTCCAGG - Intronic
1150188421 17:63211733-63211755 CTACAGATAAAAAATGAACATGG - Intronic
1151350237 17:73527542-73527564 GAACAGGAGAAGAATGCACAGGG + Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1155165602 18:23229985-23230007 TTACCTAAGAAGAATGAACCCGG + Intronic
1156607689 18:38687557-38687579 GTACAAAAGAAGAACTTACAGGG + Intergenic
1156730278 18:40185764-40185786 GAAAAGAAGAAGAATGAGGAGGG + Intergenic
1157007360 18:43599583-43599605 ATACAGAAAAAGAAGGAAGAAGG + Intergenic
1158246886 18:55442382-55442404 GATCAGAAAAAGAATGAAAAGGG + Intronic
1159432648 18:68374665-68374687 GTAATGGAGAAGTATGAACATGG + Intergenic
1159874027 18:73790351-73790373 GTAAAAAAGAAGAAAGAAGATGG + Intergenic
1160088282 18:75800877-75800899 GAAAAGGAGAAGAATGAAAAAGG - Intergenic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160829460 19:1096533-1096555 CTACGGAAGAAGAAAGAGCAGGG + Intergenic
1162258802 19:9515841-9515863 TTACGAAAGAAGAAGGAACAAGG + Intergenic
1162836829 19:13325154-13325176 GGAAAGAAGAAGAAGGAAGAAGG - Intronic
1166546492 19:43637170-43637192 GCTCAGAAGATGAATGAACCAGG + Intronic
1166920465 19:46225994-46226016 TAAAAGAAGAAGAATGAAGAAGG + Intergenic
925243234 2:2353239-2353261 GGAAAGAAGAAAAATGAAAAGGG - Intergenic
925778171 2:7355459-7355481 TAACAGAAGAAAAATAAACAAGG - Intergenic
926665865 2:15522293-15522315 CTAAAGAAGAAGAATCAATAAGG + Intronic
927324947 2:21793977-21793999 GTAGGGAAGGAGAATCAACAGGG + Intergenic
928070021 2:28205553-28205575 TTACAGATGAAGAAAGCACAGGG + Intronic
928370158 2:30734727-30734749 GCACAGAAGAGGAAGGAGCATGG - Intronic
928419928 2:31130456-31130478 GGACAGAAGAAGAATGTGAAGGG + Intronic
928446009 2:31333742-31333764 GGGCAGTAGAAGATTGAACAAGG - Intergenic
928715719 2:34057430-34057452 GTGCAGCAGAGGAATAAACAGGG + Intergenic
928953845 2:36840671-36840693 GAACATAAGAAAAACGAACATGG + Intergenic
929192263 2:39150441-39150463 TGACAGAAGAAGATTAAACATGG - Intergenic
929222335 2:39477413-39477435 GTCCAAAAGAAGAAATAACAAGG - Intergenic
933610007 2:84423894-84423916 TTACAGAAGAAAAATGTACCAGG + Intronic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
935019201 2:99214095-99214117 TACCAGAAGAAGAATGAACTGGG - Intronic
936869769 2:117122004-117122026 GTAAAGAAGGAGAAAGAAAAAGG + Intergenic
936889632 2:117354257-117354279 TTACAGATAAAGAATGACCAAGG + Intergenic
936947093 2:117940829-117940851 GTAGAGAAGAACAATGAATGAGG + Intronic
937547324 2:123038520-123038542 CTAGAGAAGAAGAAATAACAAGG + Intergenic
937758292 2:125567487-125567509 GTGGAGAATAAGAATAAACAAGG + Intergenic
938646362 2:133334564-133334586 GGACAGAAGGAGCATGAACTTGG - Intronic
939012796 2:136866166-136866188 GTAAATAAGAAGAATGAAATAGG - Intronic
939394872 2:141615739-141615761 TTTCAGAAAAAGAAAGAACAGGG + Intronic
939634764 2:144568389-144568411 GTACAGAAGGAAAAAGAATAAGG - Intergenic
939667352 2:144967915-144967937 TTAGAGCAGAAGAATGAACATGG + Intergenic
939875960 2:147578028-147578050 GTTCAGAAGGAGAATAACCAGGG + Intergenic
939954229 2:148512335-148512357 GTTCATAAGAAGAATCAAAATGG - Intronic
940039295 2:149343228-149343250 GTACTGAATAAGATCGAACATGG + Intronic
940860917 2:158769962-158769984 GTACAGAAGGAGAATAAAGGAGG - Intergenic
942640626 2:178057670-178057692 GTAGAGAAGAGGAATGAACAAGG - Intronic
943131648 2:183861221-183861243 GTACAGAAGAGAGATGATCATGG - Intergenic
943365703 2:186965779-186965801 GTAGGGAAGAAGGATGAAGAGGG + Intergenic
945541106 2:211087811-211087833 GTACAGGAGATGTATGTACAGGG + Intergenic
946454140 2:219808898-219808920 GAACAGAACAATAATGAGCAAGG - Intergenic
947014542 2:225603810-225603832 GAATAGGAGAAGAATGAAGAAGG - Intronic
947084816 2:226438853-226438875 GTAGAAAACAAGAATGAAGAGGG - Intergenic
947598586 2:231430219-231430241 GTCCAGAAGAAGAATGTCCCAGG + Intergenic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169102606 20:2964285-2964307 GAGCAGAACAAGAATGAACCAGG - Exonic
1169651407 20:7872168-7872190 GCACAGAAGAAGCATCAATATGG - Intergenic
1170770420 20:19327978-19328000 ATACAGAAAAAAAATGAACAAGG + Intronic
1170857891 20:20074279-20074301 CTGCAGAAGAAGAGAGAACACGG - Intronic
1171244241 20:23597400-23597422 ATACACAAAAAGAATGCACAGGG + Intergenic
1172217612 20:33247491-33247513 GTATAAAAGAAGAAGAAACAGGG - Intergenic
1174416118 20:50368357-50368379 GTAAATAAGAAGTATGATCAGGG - Intergenic
1174848471 20:53967650-53967672 TTTCAGAAGAAAAATGAACTTGG + Intronic
1175530364 20:59670758-59670780 GTGCAGTAGAAGATGGAACATGG - Intronic
1175912975 20:62413471-62413493 GTACAGAAGATGAAGACACAGGG - Exonic
1176273708 20:64250875-64250897 GTACTGAAGAAGAACGAAGTTGG - Intergenic
1176975156 21:15312562-15312584 GAAATGAAGAAGAATGAGCATGG + Intergenic
1177380478 21:20335158-20335180 GGACAGGAGAACAAAGAACAAGG + Intergenic
1177868243 21:26538411-26538433 ATACAGAAGAACAAAGAATAAGG - Intronic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1183321896 22:37169988-37170010 GAACAGAAGAAGGATGAATGGGG + Intronic
1183567071 22:38623172-38623194 GTACAGAAGAAGACTGACAAAGG - Exonic
950346733 3:12302242-12302264 ATACAGAAGAAGAAACAAGAAGG + Intronic
950427865 3:12934408-12934430 GTCTAGAAGAAGAGAGAACAGGG + Intronic
953090349 3:39718665-39718687 GGACAGAAGTAGAATGAATTTGG + Intergenic
955318603 3:57958847-57958869 GGACAGAAAAAGAATGAGGAAGG - Intergenic
955825994 3:62948591-62948613 CTACAAAGTAAGAATGAACAGGG + Intergenic
956887565 3:73575626-73575648 GTTCAGAAGAAGAAAGAGAAGGG + Intronic
956972897 3:74547629-74547651 GCTCAGTAGATGAATGAACAAGG - Intergenic
957396146 3:79641228-79641250 GTAAAAATGAAGAATGAAAAGGG - Intronic
957744551 3:84322191-84322213 GTACAGATGAAGAAAAAAAAAGG - Intergenic
959368710 3:105495390-105495412 GAGCACTAGAAGAATGAACAGGG + Intronic
959740442 3:109712362-109712384 CTACAGTAGAAGAAAGAATAGGG - Intergenic
960168491 3:114431143-114431165 GTACAGAAGAAGAAGGAGGAAGG + Intronic
960290964 3:115883782-115883804 TTACAAAAGAAGAATGAATCAGG + Intronic
961341882 3:126229483-126229505 ATACTGAAGAAGAATGAAGTTGG - Intergenic
962333630 3:134505177-134505199 GGACACAAGAAAAATGAAAAAGG - Intronic
962390009 3:134963181-134963203 GTACAGAAGAAGAAGGAAGAAGG - Intronic
963426364 3:145132661-145132683 GTAAAAAAGAAGAAAGAAAATGG - Intergenic
963834686 3:150046313-150046335 GTAGGGCAGAAGAAGGAACAGGG - Intronic
963892516 3:150651788-150651810 GTACTGAAAACGAATGAACTAGG - Intergenic
964018643 3:151979264-151979286 TTAGAGAAGAAAAATGAAAAAGG - Intergenic
964239192 3:154571892-154571914 TTTCAGAATAAGAATGCACAAGG - Intergenic
964449140 3:156793406-156793428 GGGCAGAACAAGAATGAAAATGG + Intergenic
964919019 3:161872974-161872996 GTACAGAAGCAGAAATAAAAAGG - Intergenic
965148317 3:164936065-164936087 GTGCATAATAAGAATGAAGAAGG - Intergenic
965545006 3:169906543-169906565 GTAGTGAAGAAGGAAGAACAAGG + Intergenic
965776333 3:172235574-172235596 GTACAGTAGTAGAAAGAGCAGGG + Intronic
966691045 3:182741920-182741942 GTACAGAGAAAGAATTAAGAGGG - Intergenic
967222492 3:187259205-187259227 GCAAATAAGCAGAATGAACAAGG - Intronic
967343979 3:188432961-188432983 GTGCAGGATAGGAATGAACAAGG + Intronic
967539079 3:190643602-190643624 GTACTGAAGAACTGTGAACATGG + Intronic
968294442 3:197563406-197563428 AGAGAAAAGAAGAATGAACAAGG + Intronic
968321178 3:197770043-197770065 TTTCAGATGCAGAATGAACAAGG - Intronic
968748090 4:2371268-2371290 GTACAAAAGAAGAATGTGCCAGG - Intronic
970087183 4:12363276-12363298 GTAGAAAAGAAGAATAAAAAAGG + Intergenic
970714898 4:18910202-18910224 GAACAGACAAATAATGAACAAGG + Intergenic
970811017 4:20094083-20094105 GTACAGAGGAAGAATACACATGG + Intergenic
970959315 4:21854526-21854548 GTACAGGTGAAGAATGACAAAGG + Intronic
971230072 4:24794501-24794523 GCAGCGACGAAGAATGAACAGGG - Intronic
971962251 4:33504204-33504226 GTACAGAACAAGAAGCAAAATGG - Intergenic
972070341 4:35011649-35011671 GTACAGAAGAAGAAAGGAGAGGG - Intergenic
972779355 4:42272707-42272729 TTCCAGAAGAAAAATCAACATGG - Intergenic
973296109 4:48522384-48522406 GTAAAGAAGGAGAAGGCACATGG - Intronic
973937769 4:55866668-55866690 GTGAATAAGAAAAATGAACACGG + Intronic
974810649 4:66941744-66941766 CTACAGAAGAAGGCTGAAAATGG + Intergenic
976116982 4:81738383-81738405 ATACAGTGGAAGAATAAACATGG - Intronic
976820883 4:89205779-89205801 ATACAGAAGAAGATGGCACAAGG - Intergenic
978059207 4:104315347-104315369 GTACAGAAGAAGAAATGACAAGG + Intergenic
978748960 4:112225548-112225570 GAACTGAAGAAAAGTGAACAAGG - Intergenic
979650048 4:123118169-123118191 GTACAGTGGTAGAAGGAACAAGG - Intronic
980080594 4:128340172-128340194 GTAAAGAAGAGGAATAGACATGG - Intergenic
980435659 4:132769200-132769222 GTAAAGATGAAAAATGAACGTGG - Intergenic
980463856 4:133150210-133150232 GTACAGGAGGAGCAGGAACATGG + Exonic
981023054 4:140048926-140048948 GTGAAGAGGAAGAATGAACAGGG + Intronic
981116861 4:141001366-141001388 GTAGAGAAGACAAATGAAGAGGG - Intronic
981163340 4:141525613-141525635 GAACAGAAGTAAAATGAATATGG - Intergenic
982192757 4:152875598-152875620 GCACAAAAGGAAAATGAACAGGG - Intronic
982359863 4:154507971-154507993 GTAAAGAAGGAAAATGGACAAGG + Intergenic
982641524 4:157967779-157967801 GTATACAAGTAGAAAGAACATGG - Intergenic
982941231 4:161559337-161559359 GCAAAGGAGAAGAAAGAACAAGG - Intronic
983870699 4:172822168-172822190 GTACAGTAGAATAATTAACAGGG - Intronic
984356442 4:178665524-178665546 GTCCAAAAGAAGAATGAAGCAGG + Intergenic
984488786 4:180405903-180405925 ACACAGAAGAAGAACGGACATGG + Intergenic
985679994 5:1250943-1250965 GAAGAGAAGAAGAAGGAAGAAGG - Intergenic
985826336 5:2194264-2194286 GTACAGATGAAGAATCAATCAGG + Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
988286958 5:29231850-29231872 ATACAGAAAAATAAAGAACAAGG + Intergenic
989443585 5:41502512-41502534 GTACAGATGAAGTAGGAAGAAGG + Intronic
989494080 5:42090856-42090878 CTACTGAGGAAGAATGAAGATGG - Intergenic
990454814 5:55974871-55974893 GTACAGAAAATGACTGACCAAGG + Intronic
990902042 5:60762119-60762141 GTAAAGAAGAAGAAGGATTAAGG + Intronic
991218125 5:64180056-64180078 ATCCAGCAGAAAAATGAACAAGG - Intronic
991530132 5:67605547-67605569 GTACAGACAAAGAAAAAACAAGG - Intergenic
991548533 5:67810944-67810966 GTAGAGAAGAAGCCTGAAAATGG - Intergenic
993047975 5:82890005-82890027 GACCAGAAGAAGAATGAACTGGG + Intergenic
993421467 5:87706857-87706879 GAACAACAGAAGACTGAACATGG - Intergenic
993541227 5:89154528-89154550 GTACAGAAGATGAATGCACATGG - Intergenic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
995392014 5:111650254-111650276 CTACAGAAGTAGAGTAAACAGGG + Intergenic
996385233 5:122903435-122903457 GTATAGAAGAAACATAAACAGGG - Intronic
996436972 5:123444934-123444956 CTGCAGAAGAAGAATTTACAAGG + Intergenic
997015245 5:129925183-129925205 GTAAAGCATAAGAATGAACCTGG + Intronic
997068177 5:130588444-130588466 CTACTAAAGAAGAATGAAGAAGG + Intergenic
997262575 5:132475990-132476012 GTACATAAGTAAAAGGAACATGG - Intronic
998588312 5:143451306-143451328 CAACAGAAGAAGAATAAAAAGGG - Intergenic
999886054 5:155924255-155924277 GCACAAAAGAAGACAGAACAAGG + Intronic
999970020 5:156850206-156850228 GTACAAAAGAACTATGAAAAAGG + Intergenic
1000157019 5:158562266-158562288 TTACTGGAGAAGAGTGAACAGGG - Intergenic
1000309482 5:160028402-160028424 AGACTGAAGAAAAATGAACAGGG - Intronic
1000431528 5:161158318-161158340 AGACAGAAGAGGAAAGAACACGG + Intergenic
1000796051 5:165666345-165666367 GTACACATGAAGTATGACCAGGG - Intergenic
1002203731 5:177548144-177548166 GTCCACAGGAAGAATGAACTTGG + Intronic
1002554483 5:180024820-180024842 GTTTAGAGGAAGAATGAAAAGGG - Intronic
1003167294 6:3691874-3691896 GAACAGAAGAAGAGACAACATGG + Intergenic
1003523251 6:6876672-6876694 GTAAAGAAGAATCATGAAGAGGG - Intergenic
1004249862 6:14014974-14014996 GTCCAAAGGAAGAATGGACAGGG - Intergenic
1004665320 6:17743981-17744003 ATACTGAAGAAAAATGAAGAGGG + Intergenic
1005800343 6:29415594-29415616 GTAAAAAAAAATAATGAACAAGG - Intronic
1007172525 6:39873714-39873736 GCACAGATGTGGAATGAACATGG + Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1008443699 6:51562590-51562612 GTACAGATCAAGAAAGAACATGG - Intergenic
1009033701 6:58091462-58091484 GAACAGAAAAAGAAAAAACAGGG - Intergenic
1009209312 6:60843170-60843192 GAACAGAAAAAGAAAAAACAGGG - Intergenic
1009294470 6:61928341-61928363 GTAAATAAGAAGAAGGAATAAGG - Intronic
1010111081 6:72233501-72233523 GTACAGAAAAAAAAAAAACAGGG - Intronic
1010912256 6:81573064-81573086 GTAAAGAAGACCAATTAACAAGG + Intronic
1012153585 6:95787860-95787882 GGAAAGAAAAAAAATGAACATGG - Intergenic
1012861673 6:104567856-104567878 GTACACAAAAAGAAGGAAAATGG + Intergenic
1013033120 6:106355575-106355597 GTGCAGAATAAGAATAAAAAAGG - Intergenic
1013279067 6:108617843-108617865 GTACAGTAAAAGAATGGAGAAGG + Intronic
1013867645 6:114718224-114718246 GTAAAGAACATAAATGAACAAGG + Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015305657 6:131704415-131704437 GTCTAGAAGAAGAATGGATAAGG + Intronic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1016026953 6:139297215-139297237 GTAAAGAAGAAGAAGAAAAAAGG - Intergenic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1016087671 6:139934371-139934393 TTACAGAAGAAGAAAGAGCATGG + Intergenic
1016519906 6:144935497-144935519 TTAAAAAAGGAGAATGAACAGGG - Intergenic
1017041851 6:150314367-150314389 GAACAGGAGAAGGAGGAACAGGG + Intergenic
1018399974 6:163413248-163413270 TTACAGATGAAGAAAGAATACGG - Intergenic
1018876918 6:167828533-167828555 TTACAGAAGATGAATGAATCAGG - Intronic
1019195621 6:170280880-170280902 GTACGAAAGAGGAAAGAACACGG + Intergenic
1019233810 6:170591588-170591610 CTACAGAAGAAAAAAGAGCACGG + Intergenic
1021768408 7:23972116-23972138 TCAGAGAAAAAGAATGAACAGGG - Intergenic
1021884605 7:25126256-25126278 CCACTGAAGAAGAATGAATAAGG - Intergenic
1022771693 7:33480327-33480349 ATACAGAAGAAGGATAAAGAGGG + Intronic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1024305606 7:47926835-47926857 CTAGAGAAGATGAGTGAACAAGG + Intronic
1027433355 7:78136863-78136885 TCACAATAGAAGAATGAACAAGG - Intronic
1027488293 7:78789022-78789044 GTTGAGAAGAAGAATGTGCAGGG - Intronic
1028167836 7:87559422-87559444 GAACAAAAAAAGAATGAATAGGG - Intronic
1028194796 7:87893603-87893625 CTTCAGAATAAGAATTAACAGGG - Intronic
1028306044 7:89266140-89266162 GCTCAGAAGAAGAATGGAAATGG - Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1029919842 7:104251586-104251608 TTACTGAGGAAGAATGAAGAGGG + Intergenic
1030137001 7:106263004-106263026 GCACAGAAGAAATAGGAACAGGG - Intronic
1031560901 7:123236787-123236809 GAACAGAAGAAGAAAGAAGGAGG - Intergenic
1031857306 7:126937986-126938008 GGACAAGAGAAGAATGGACATGG - Intronic
1031909089 7:127494858-127494880 ATAAAAAAGAAGAAAGAACAAGG + Intergenic
1032350639 7:131159916-131159938 GCACAGAAGAGGTAGGAACATGG + Intronic
1032928466 7:136637222-136637244 GTACTTAACAAGAATGAGCAGGG + Intergenic
1033739773 7:144262646-144262668 GTCTAGAAGAAGAATGGATAAGG + Intergenic
1033869469 7:145733036-145733058 TTACAGTAAAAGAATCAACAAGG - Intergenic
1035961608 8:4144321-4144343 GAAGAGAAGTAGAATGAATATGG - Intronic
1036541325 8:9715083-9715105 GTACAGGAGGAGTATGAAGAAGG + Intronic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1039644952 8:39271174-39271196 GTAAAGAAAAAGAATGTATAGGG + Intronic
1039645188 8:39274612-39274634 GTAAAGAAAAAGAATGTATAGGG + Intronic
1039699805 8:39950513-39950535 TCACAGAAAAAGAATGAACATGG + Intronic
1039772419 8:40700790-40700812 CTGTAGAAGAAGAATGTACAAGG - Intronic
1040434033 8:47372169-47372191 GTACAGAAGAAGGATCAGAAAGG - Intronic
1040456421 8:47602882-47602904 ATCCAGAAGAACAATGGACAGGG - Intronic
1040489156 8:47903648-47903670 GTAAAGAAGCAGCATGAACTCGG - Intronic
1040581663 8:48703651-48703673 GCACAGAAGAGGACTGACCAGGG + Intergenic
1040706973 8:50140310-50140332 GCTCAGAAGAAGACTGAACATGG - Intronic
1041288907 8:56289474-56289496 TTACAGAAGAGGAATCACCAAGG + Intergenic
1041806318 8:61853696-61853718 GTTAAGAAAAATAATGAACATGG - Intergenic
1041975291 8:63792719-63792741 GCACTGAAGAAGAATGAGAAAGG - Intergenic
1042421026 8:68589678-68589700 GGAAGGAAGAAGAAAGAACAAGG + Intronic
1042909826 8:73815073-73815095 ATAAAAAATAAGAATGAACAGGG + Intronic
1043467186 8:80522489-80522511 GTAAATAAGAAAAATGAACAGGG - Exonic
1044906520 8:97009802-97009824 GTACAGTGGAAGAATGGAGACGG + Intronic
1045642132 8:104262369-104262391 GTATAGAAAAAGAAGGAACCAGG + Intergenic
1045706653 8:104931130-104931152 GTAGAAAAGTAGAGTGAACATGG - Intronic
1047690931 8:127353900-127353922 GGAAAGAAGAAGAAAGAAGAAGG + Intergenic
1050467048 9:5937951-5937973 GTTCAGAATAATAATGAAAAAGG - Intronic
1052332903 9:27288623-27288645 ATTCAGTAGAAGAATGAACTAGG + Intronic
1052333402 9:27295122-27295144 GTATATGAGAAGAATGTACATGG + Intronic
1053164049 9:35832302-35832324 GTCCAGAAGAAGCATGAGTAAGG - Intronic
1053324083 9:37126680-37126702 GAAGAGAAGAAGAAAGACCATGG - Exonic
1055321835 9:75089449-75089471 GAACAGAGCAAAAATGAACAAGG - Intronic
1055742696 9:79407380-79407402 GTCCAGAAGAAGAAGAGACACGG - Intergenic
1056113476 9:83419723-83419745 GTACAGAACAAGAAAGAGCTGGG + Intronic
1056406875 9:86283015-86283037 CCACAAAAGAAGAATGAAAATGG - Intergenic
1057261144 9:93585540-93585562 GTCAGGAACAAGAATGAACAAGG - Intronic
1058435073 9:104955086-104955108 GTAAATAACAAGAGTGAACATGG + Intergenic
1059162264 9:112046323-112046345 ATTCAGAAGAAAAATAAACATGG - Intronic
1060213456 9:121724333-121724355 GAAGAGAAGAAGAGGGAACAAGG - Intronic
1060328276 9:122640144-122640166 GTAAAGAAGGAAAATGAAGAAGG - Intergenic
1060675992 9:125515214-125515236 TTACAAAAGAAGAAAGACCAAGG + Intronic
1062672463 9:137719540-137719562 GTACAGAAGAATACTGCAAAAGG - Intronic
1062676205 9:137745983-137746005 ATCCAGAAGAAAAATGAGCAGGG - Intronic
1186050116 X:5583231-5583253 GTAAAGAAGAAGAGTGAAAAGGG - Intergenic
1186471176 X:9823145-9823167 GAAAAGAAGAAGAAGGAAGAAGG - Intronic
1187185363 X:16979558-16979580 GTCCAGAATAAAAGTGAACATGG + Intronic
1189128626 X:38475226-38475248 GTACAGTAGAAGTAAGAACCAGG - Intronic
1190178133 X:48168191-48168213 GGACAGATAAAGAGTGAACATGG + Intergenic
1190184101 X:48219833-48219855 GGATAGATGAAGAGTGAACATGG + Intronic
1191067705 X:56367645-56367667 GAGCAGAAGAAGAATCAAAAAGG - Intergenic
1191664122 X:63680910-63680932 GTAGAGAAGAAGAAGGGACATGG - Intronic
1191792967 X:64990695-64990717 ATACAGAAAGAGAAGGAACAGGG - Intronic
1191815064 X:65235020-65235042 GTAGCCAAAAAGAATGAACAAGG - Intergenic
1192339051 X:70247178-70247200 CTACAGAAGAAAAATTAGCAAGG + Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1193329894 X:80223979-80224001 CTACAGAAGAAGAAGCACCAGGG - Intergenic
1194256831 X:91645447-91645469 GCTCAGAAGAAGAAAGAAAAAGG + Intergenic
1194420994 X:93672813-93672835 CTACAGAAGAAGAATGTGAATGG - Exonic
1194940747 X:100007225-100007247 ATACAGAAGAAAAATAAATAAGG + Intergenic
1195112569 X:101662057-101662079 ATGCAGAAGAAGAAAGAAAAGGG - Intergenic
1196345627 X:114653658-114653680 ATAAAGAAGAAAGATGAACAAGG - Intronic
1197480468 X:126978371-126978393 GTATGGAAGACAAATGAACAGGG - Intergenic
1198296404 X:135292022-135292044 GGAGAGAAGAAGATGGAACAGGG - Intronic
1198791355 X:140350188-140350210 GTAGAGAAGAAAAATGAAGCAGG - Intergenic
1200274533 X:154719114-154719136 GTCTAGCAGAAGAATGAACCAGG + Intronic
1200314365 X:155116196-155116218 GTAGAGAAGAGGAGTGAAGAGGG - Intronic
1200923783 Y:8636306-8636328 TCACAGAAAAATAATGAACACGG - Intergenic
1200930851 Y:8695793-8695815 CTACAGAAAAAGAGAGAACACGG + Intergenic
1201773429 Y:17640435-17640457 GTACAGATGAAGAGTTGACACGG - Intergenic
1201828126 Y:18265551-18265573 GTACAGATGAAGAGTTGACACGG + Intergenic