ID: 924910097

View in Genome Browser
Species Human (GRCh38)
Location 1:248500725-248500747
Sequence GAGGCTCGGTCTTTGTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924910094_924910097 -2 Left 924910094 1:248500704-248500726 CCTAGTGTTGGTGTAGATCTGGA No data
Right 924910097 1:248500725-248500747 GAGGCTCGGTCTTTGTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924910097 Original CRISPR GAGGCTCGGTCTTTGTGTAC TGG Intergenic
No off target data available for this crispr