ID: 924914005

View in Genome Browser
Species Human (GRCh38)
Location 1:248547322-248547344
Sequence GAGGCTCGGTCTTTGTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924914005_924914008 -2 Left 924914005 1:248547322-248547344 CCAGTACACAAAGACCGAGCCTC No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924914005 Original CRISPR GAGGCTCGGTCTTTGTGTAC TGG (reversed) Intergenic
No off target data available for this crispr