ID: 924914008

View in Genome Browser
Species Human (GRCh38)
Location 1:248547343-248547365
Sequence TCCAGATCTACACCAACACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924914001_924914008 19 Left 924914001 1:248547301-248547323 CCCACAACCACTGACTCCAGGCC No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data
924913998_924914008 21 Left 924913998 1:248547299-248547321 CCCCCACAACCACTGACTCCAGG No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data
924914002_924914008 18 Left 924914002 1:248547302-248547324 CCACAACCACTGACTCCAGGCCA No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data
924913997_924914008 29 Left 924913997 1:248547291-248547313 CCAGGCAGCCCCCACAACCACTG No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data
924914004_924914008 3 Left 924914004 1:248547317-248547339 CCAGGCCAGTACACAAAGACCGA No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data
924914005_924914008 -2 Left 924914005 1:248547322-248547344 CCAGTACACAAAGACCGAGCCTC No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data
924914003_924914008 12 Left 924914003 1:248547308-248547330 CCACTGACTCCAGGCCAGTACAC No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data
924914000_924914008 20 Left 924914000 1:248547300-248547322 CCCCACAACCACTGACTCCAGGC No data
Right 924914008 1:248547343-248547365 TCCAGATCTACACCAACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924914008 Original CRISPR TCCAGATCTACACCAACACT AGG Intergenic
No off target data available for this crispr