ID: 924919015

View in Genome Browser
Species Human (GRCh38)
Location 1:248606485-248606507
Sequence AGCTTAAAACATAAGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924919015_924919020 9 Left 924919015 1:248606485-248606507 CCCCATTGCTTATGTTTTAAGCT No data
Right 924919020 1:248606517-248606539 ATCAGATGGTTGTTGGTTTGTGG No data
924919015_924919018 -5 Left 924919015 1:248606485-248606507 CCCCATTGCTTATGTTTTAAGCT No data
Right 924919018 1:248606503-248606525 AAGCTTTGTCAAAGATCAGATGG No data
924919015_924919019 2 Left 924919015 1:248606485-248606507 CCCCATTGCTTATGTTTTAAGCT No data
Right 924919019 1:248606510-248606532 GTCAAAGATCAGATGGTTGTTGG 0: 416
1: 1474
2: 1581
3: 1564
4: 1472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924919015 Original CRISPR AGCTTAAAACATAAGCAATG GGG (reversed) Intergenic
No off target data available for this crispr